Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0501608561:

Variant ID: vg0501608561 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 1608561
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.88, T: 0.12, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:

AACCGTCGAAGGGAGCTCACTTTTGAGGCAGGGGATTACGTGTATCTTCGTGTCACTCCGCTCCGGGGAGTACACCGCTTTCAGACGAAAGGCAAGTTGG[T/C]
ACCACGCTTCGTGGGACCATACAAAATCCTGGAACGAAGGGGGGAAGTTGCTTATCAGTTAGAACTTCCATCCAATATGATCGGCATCCATGACGTGTTC

Reverse complement sequence

GAACACGTCATGGATGCCGATCATATTGGATGGAAGTTCTAACTGATAAGCAACTTCCCCCCTTCGTTCCAGGATTTTGTATGGTCCCACGAAGCGTGGT[A/G]
CCAACTTGCCTTTCGTCTGAAAGCGGTGTACTCCCCGGAGCGGAGTGACACGAAGATACACGTAATCCCCTGCCTCAAAAGTGAGCTCCCTTCGACGGTT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	49.50%	0.40%	26.49%	23.61%	NA
All Indica	2759	19.30%	0.60%	42.15%	37.98%	NA
All Japonica	1512	98.40%	0.00%	0.33%	1.26%	NA
Aus	269	71.00%	0.40%	22.68%	5.95%	NA
Indica I	595	12.90%	0.30%	27.56%	59.16%	NA
Indica II	465	20.90%	0.40%	31.61%	47.10%	NA
Indica III	913	23.00%	0.50%	59.58%	16.87%	NA
Indica Intermediate	786	18.80%	0.90%	39.19%	41.09%	NA
Temperate Japonica	767	99.20%	0.00%	0.00%	0.78%	NA
Tropical Japonica	504	98.00%	0.00%	0.60%	1.39%	NA
Japonica Intermediate	241	96.70%	0.00%	0.83%	2.49%	NA
VI/Aromatic	96	64.60%	3.10%	10.42%	21.88%	NA
Intermediate	90	72.20%	0.00%	14.44%	13.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0501608561	T -> DEL	LOC_Os05g03690.1	N	frameshift_variant	Average:9.85; most accessible tissue: Callus, score: 17.655	N	N	N	N
vg0501608561	T -> C	LOC_Os05g03690.1	missense_variant ; p.Val1561Ala; MODERATE	nonsynonymous_codon ; V1561A	Average:9.85; most accessible tissue: Callus, score: 17.655	benign	-1.401	TOLERATED	1.00

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0501608561	NA	3.53E-30	mr1298	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501608561	NA	1.69E-15	mr1324	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501608561	NA	1.54E-12	mr1449	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501608561	NA	1.37E-40	mr1480	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501608561	NA	6.80E-26	mr1731	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501608561	NA	1.06E-08	mr1776	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501608561	NA	1.56E-21	mr1839	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501608561	NA	1.10E-33	mr1932	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501608561	NA	2.57E-16	mr1950	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501608561	NA	2.14E-16	mr1968	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501608561	NA	1.19E-08	mr1986	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501608561	NA	7.76E-07	mr1020_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501608561	NA	9.46E-16	mr1133_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501608561	NA	2.02E-54	mr1141_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501608561	NA	1.14E-19	mr1167_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501608561	NA	3.69E-21	mr1298_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501608561	NA	5.67E-34	mr1448_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501608561	NA	1.20E-51	mr1480_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501608561	NA	1.43E-11	mr1667_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501608561	NA	1.78E-21	mr1698_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501608561	NA	5.06E-18	mr1712_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501608561	NA	4.89E-13	mr1717_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501608561	NA	1.34E-14	mr1726_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501608561	NA	8.64E-20	mr1731_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501608561	NA	3.54E-07	mr1749_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501608561	7.67E-07	NA	mr1750_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501608561	NA	3.10E-08	mr1821_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501608561	NA	3.91E-18	mr1945_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501608561	NA	8.57E-22	mr1968_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251