Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0501608561:

Variant ID: vg0501608561 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 1608561
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.88, T: 0.12, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


AACCGTCGAAGGGAGCTCACTTTTGAGGCAGGGGATTACGTGTATCTTCGTGTCACTCCGCTCCGGGGAGTACACCGCTTTCAGACGAAAGGCAAGTTGG[T/C]
ACCACGCTTCGTGGGACCATACAAAATCCTGGAACGAAGGGGGGAAGTTGCTTATCAGTTAGAACTTCCATCCAATATGATCGGCATCCATGACGTGTTC

Reverse complement sequence

GAACACGTCATGGATGCCGATCATATTGGATGGAAGTTCTAACTGATAAGCAACTTCCCCCCTTCGTTCCAGGATTTTGTATGGTCCCACGAAGCGTGGT[A/G]
CCAACTTGCCTTTCGTCTGAAAGCGGTGTACTCCCCGGAGCGGAGTGACACGAAGATACACGTAATCCCCTGCCTCAAAAGTGAGCTCCCTTCGACGGTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.50% 0.40% 26.49% 23.61% NA
All Indica  2759 19.30% 0.60% 42.15% 37.98% NA
All Japonica  1512 98.40% 0.00% 0.33% 1.26% NA
Aus  269 71.00% 0.40% 22.68% 5.95% NA
Indica I  595 12.90% 0.30% 27.56% 59.16% NA
Indica II  465 20.90% 0.40% 31.61% 47.10% NA
Indica III  913 23.00% 0.50% 59.58% 16.87% NA
Indica Intermediate  786 18.80% 0.90% 39.19% 41.09% NA
Temperate Japonica  767 99.20% 0.00% 0.00% 0.78% NA
Tropical Japonica  504 98.00% 0.00% 0.60% 1.39% NA
Japonica Intermediate  241 96.70% 0.00% 0.83% 2.49% NA
VI/Aromatic  96 64.60% 3.10% 10.42% 21.88% NA
Intermediate  90 72.20% 0.00% 14.44% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0501608561 T -> DEL LOC_Os05g03690.1 N frameshift_variant Average:9.85; most accessible tissue: Callus, score: 17.655 N N N N
vg0501608561 T -> C LOC_Os05g03690.1 missense_variant ; p.Val1561Ala; MODERATE nonsynonymous_codon ; V1561A Average:9.85; most accessible tissue: Callus, score: 17.655 benign -1.401 TOLERATED 1.00

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0501608561 NA 3.53E-30 mr1298 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501608561 NA 1.69E-15 mr1324 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501608561 NA 1.54E-12 mr1449 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501608561 NA 1.37E-40 mr1480 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501608561 NA 6.80E-26 mr1731 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501608561 NA 1.06E-08 mr1776 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501608561 NA 1.56E-21 mr1839 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501608561 NA 1.10E-33 mr1932 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501608561 NA 2.57E-16 mr1950 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501608561 NA 2.14E-16 mr1968 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501608561 NA 1.19E-08 mr1986 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501608561 NA 7.76E-07 mr1020_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501608561 NA 9.46E-16 mr1133_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501608561 NA 2.02E-54 mr1141_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501608561 NA 1.14E-19 mr1167_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501608561 NA 3.69E-21 mr1298_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501608561 NA 5.67E-34 mr1448_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501608561 NA 1.20E-51 mr1480_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501608561 NA 1.43E-11 mr1667_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501608561 NA 1.78E-21 mr1698_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501608561 NA 5.06E-18 mr1712_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501608561 NA 4.89E-13 mr1717_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501608561 NA 1.34E-14 mr1726_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501608561 NA 8.64E-20 mr1731_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501608561 NA 3.54E-07 mr1749_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501608561 7.67E-07 NA mr1750_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501608561 NA 3.10E-08 mr1821_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501608561 NA 3.91E-18 mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501608561 NA 8.57E-22 mr1968_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251