\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0501597771:

Variant ID: vg0501597771 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 1597771
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAATTTCGAGGATGTATTTTAGAGTCGATTTGGGACGCGACACCAGAGTAGGCATCTAGAAAACACAAAAGGTCGCACCCCGCAGTGGAGTCGACTATCT[G/A]
ATCTATGCGTGGTAAAGGGAAGGGATCTTTAGGGCATGCCTTGTTGAGGTCCGTGTAGTCAATGCACATCCGGAGCTTACCGTTGGCCTTCGGGACGACC

Reverse complement sequence

GGTCGTCCCGAAGGCCAACGGTAAGCTCCGGATGTGCATTGACTACACGGACCTCAACAAGGCATGCCCTAAAGATCCCTTCCCTTTACCACGCATAGAT[C/T]
AGATAGTCGACTCCACTGCGGGGTGCGACCTTTTGTGTTTTCTAGATGCCTACTCTGGTGTCGCGTCCCAAATCGACTCTAAAATACATCCTCGAAATTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.30% 0.20% 0.34% 2.18% NA
All Indica  2759 95.40% 0.30% 0.58% 3.73% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 86.70% 0.80% 2.02% 10.42% NA
Indica II  465 96.10% 0.00% 0.22% 3.66% NA
Indica III  913 99.90% 0.00% 0.00% 0.11% NA
Indica Intermediate  786 96.30% 0.40% 0.38% 2.93% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0501597771 G -> DEL N N silent_mutation Average:30.021; most accessible tissue: Minghui63 young leaf, score: 50.756 N N N N
vg0501597771 G -> A LOC_Os05g03670.1 upstream_gene_variant ; 1678.0bp to feature; MODIFIER silent_mutation Average:30.021; most accessible tissue: Minghui63 young leaf, score: 50.756 N N N N
vg0501597771 G -> A LOC_Os05g03680.1 downstream_gene_variant ; 352.0bp to feature; MODIFIER silent_mutation Average:30.021; most accessible tissue: Minghui63 young leaf, score: 50.756 N N N N
vg0501597771 G -> A LOC_Os05g03670-LOC_Os05g03680 intergenic_region ; MODIFIER silent_mutation Average:30.021; most accessible tissue: Minghui63 young leaf, score: 50.756 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0501597771 2.60E-06 1.49E-06 mr1057 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501597771 9.44E-06 NA mr1272 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501597771 8.24E-06 8.24E-06 mr1275 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501597771 NA 1.43E-06 mr1352 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501597771 3.70E-08 3.70E-08 mr1428 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501597771 2.00E-06 2.00E-06 mr1521 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501597771 2.88E-06 2.88E-06 mr1738 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251