\
| Variant ID: vg0501597771 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 1597771 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CAATTTCGAGGATGTATTTTAGAGTCGATTTGGGACGCGACACCAGAGTAGGCATCTAGAAAACACAAAAGGTCGCACCCCGCAGTGGAGTCGACTATCT[G/A]
ATCTATGCGTGGTAAAGGGAAGGGATCTTTAGGGCATGCCTTGTTGAGGTCCGTGTAGTCAATGCACATCCGGAGCTTACCGTTGGCCTTCGGGACGACC
GGTCGTCCCGAAGGCCAACGGTAAGCTCCGGATGTGCATTGACTACACGGACCTCAACAAGGCATGCCCTAAAGATCCCTTCCCTTTACCACGCATAGAT[C/T]
AGATAGTCGACTCCACTGCGGGGTGCGACCTTTTGTGTTTTCTAGATGCCTACTCTGGTGTCGCGTCCCAAATCGACTCTAAAATACATCCTCGAAATTG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 97.30% | 0.20% | 0.34% | 2.18% | NA |
| All Indica | 2759 | 95.40% | 0.30% | 0.58% | 3.73% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 86.70% | 0.80% | 2.02% | 10.42% | NA |
| Indica II | 465 | 96.10% | 0.00% | 0.22% | 3.66% | NA |
| Indica III | 913 | 99.90% | 0.00% | 0.00% | 0.11% | NA |
| Indica Intermediate | 786 | 96.30% | 0.40% | 0.38% | 2.93% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0501597771 | G -> DEL | N | N | silent_mutation | Average:30.021; most accessible tissue: Minghui63 young leaf, score: 50.756 | N | N | N | N |
| vg0501597771 | G -> A | LOC_Os05g03670.1 | upstream_gene_variant ; 1678.0bp to feature; MODIFIER | silent_mutation | Average:30.021; most accessible tissue: Minghui63 young leaf, score: 50.756 | N | N | N | N |
| vg0501597771 | G -> A | LOC_Os05g03680.1 | downstream_gene_variant ; 352.0bp to feature; MODIFIER | silent_mutation | Average:30.021; most accessible tissue: Minghui63 young leaf, score: 50.756 | N | N | N | N |
| vg0501597771 | G -> A | LOC_Os05g03670-LOC_Os05g03680 | intergenic_region ; MODIFIER | silent_mutation | Average:30.021; most accessible tissue: Minghui63 young leaf, score: 50.756 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0501597771 | 2.60E-06 | 1.49E-06 | mr1057 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501597771 | 9.44E-06 | NA | mr1272 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501597771 | 8.24E-06 | 8.24E-06 | mr1275 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501597771 | NA | 1.43E-06 | mr1352 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501597771 | 3.70E-08 | 3.70E-08 | mr1428 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501597771 | 2.00E-06 | 2.00E-06 | mr1521 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501597771 | 2.88E-06 | 2.88E-06 | mr1738 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |