Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0501584678:

Variant ID: vg0501584678 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 1584678
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AGGTCCCCAGGGGGAGTGGGGCTTGTGCCGACACGACACGCGACAACTCATCAGCGACTGTGTTGTCGCGTCGGGGCACGTGACGGAGCTTGAGTCCGTC[A/G]
AAGTGGCGTTCTATGCGCCGCACTTCGCGGACATATGCGTCCATTTGTGGGTCGGTGCACTGGTACTCTTTGGATACTTGATTCACGACCAGCTGGGAGT

Reverse complement sequence

ACTCCCAGCTGGTCGTGAATCAAGTATCCAAAGAGTACCAGTGCACCGACCCACAAATGGACGCATATGTCCGCGAAGTGCGGCGCATAGAACGCCACTT[T/C]
GACGGACTCAAGCTCCGTCACGTGCCCCGACGCGACAACACAGTCGCTGATGAGTTGTCGCGTGTCGTGTCGGCACAAGCCCCACTCCCCCTGGGGACCT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.60%	35.00%	0.42%	0.00%	NA
All Indica	2759	94.30%	5.00%	0.65%	0.00%	NA
All Japonica	1512	3.40%	96.60%	0.00%	0.00%	NA
Aus	269	98.10%	1.50%	0.37%	0.00%	NA
Indica I	595	98.50%	1.50%	0.00%	0.00%	NA
Indica II	465	96.10%	3.90%	0.00%	0.00%	NA
Indica III	913	88.90%	9.30%	1.75%	0.00%	NA
Indica Intermediate	786	96.40%	3.30%	0.25%	0.00%	NA
Temperate Japonica	767	1.30%	98.70%	0.00%	0.00%	NA
Tropical Japonica	504	5.40%	94.60%	0.00%	0.00%	NA
Japonica Intermediate	241	5.80%	94.20%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	45.60%	53.30%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0501584678	A -> G	LOC_Os05g03660.1	synonymous_variant ; p.Phe279Phe; LOW	synonymous_codon	Average:57.992; most accessible tissue: Minghui63 young leaf, score: 85.826	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0501584678	NA	1.09E-21	mr1122	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501584678	NA	7.72E-44	mr1141	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501584678	NA	7.43E-30	mr1298	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501584678	NA	2.35E-15	mr1324	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501584678	NA	3.26E-13	mr1449	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501584678	NA	1.40E-42	mr1480	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501584678	NA	1.32E-51	mr1692	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501584678	NA	1.04E-25	mr1731	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501584678	2.20E-06	NA	mr1750	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501584678	NA	2.00E-21	mr1839	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501584678	NA	4.48E-07	mr1915	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501584678	NA	2.17E-35	mr1932	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501584678	NA	1.79E-74	mr1934	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501584678	NA	4.21E-17	mr1950	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501584678	NA	3.40E-17	mr1968	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501584678	NA	1.15E-08	mr1986	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501584678	NA	4.45E-06	mr1020_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501584678	NA	1.81E-14	mr1133_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501584678	NA	1.86E-54	mr1141_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501584678	NA	2.00E-19	mr1167_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501584678	NA	5.81E-35	mr1448_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501584678	NA	4.61E-53	mr1480_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501584678	NA	1.36E-10	mr1667_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501584678	NA	1.67E-17	mr1712_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501584678	NA	1.20E-12	mr1717_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501584678	NA	8.22E-08	mr1821_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501584678	NA	2.92E-19	mr1945_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501584678	NA	3.37E-23	mr1968_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251