\
| Variant ID: vg0501576033 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 1576033 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, A: 0.04, others allele: 0.00, population size: 90. )
GACGGGTCATACCTACCTCCACTCCGCCGGAAGCAGATGCGACGTGGGAGCACGGTTGTCCGTCCAGTCAGACGTGACCGGCGTCAGGCCGGTCATAGAC[A/C]
GGTCATTCTTGACCATCGCGCGTCAGTTTAACACGCCGCACGTCTACCCCACTACATTAAATGCAACAGGGGGCAGTTGGGGCGCTGCGCGCATTAAAGG
CCTTTAATGCGCGCAGCGCCCCAACTGCCCCCTGTTGCATTTAATGTAGTGGGGTAGACGTGCGGCGTGTTAAACTGACGCGCGATGGTCAAGAATGACC[T/G]
GTCTATGACCGGCCTGACGCCGGTCACGTCTGACTGGACGGACAACCGTGCTCCCACGTCGCATCTGCTTCCGGCGGAGTGGAGGTAGGTATGACCCGTC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.00% | 33.80% | 0.17% | 0.00% | NA |
| All Indica | 2759 | 94.90% | 4.90% | 0.14% | 0.00% | NA |
| All Japonica | 1512 | 12.50% | 87.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 97.40% | 2.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.30% | 0.50% | 0.17% | 0.00% | NA |
| Indica II | 465 | 97.40% | 2.40% | 0.22% | 0.00% | NA |
| Indica III | 913 | 89.50% | 10.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 96.40% | 3.30% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 19.30% | 80.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 5.40% | 94.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 5.80% | 94.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 12.50% | 86.50% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 43.30% | 53.30% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0501576033 | A -> C | LOC_Os05g03650.1 | upstream_gene_variant ; 158.0bp to feature; MODIFIER | silent_mutation | Average:50.702; most accessible tissue: Zhenshan97 flag leaf, score: 76.642 | N | N | N | N |
| vg0501576033 | A -> C | LOC_Os05g03640-LOC_Os05g03650 | intergenic_region ; MODIFIER | silent_mutation | Average:50.702; most accessible tissue: Zhenshan97 flag leaf, score: 76.642 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0501576033 | NA | 4.46E-14 | mr1062 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501576033 | NA | 1.28E-09 | mr1322 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501576033 | NA | 6.04E-14 | mr1449 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501576033 | NA | 3.45E-41 | mr1480 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501576033 | NA | 8.18E-08 | mr1506 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501576033 | NA | 2.80E-07 | mr1527 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501576033 | NA | 6.60E-18 | mr1529 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501576033 | NA | 5.97E-12 | mr1579 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501576033 | NA | 1.11E-19 | mr1627 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501576033 | NA | 1.17E-18 | mr1715 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501576033 | NA | 4.21E-12 | mr1751 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501576033 | NA | 4.97E-18 | mr1968 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501576033 | NA | 4.47E-09 | mr1986 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501576033 | NA | 9.70E-08 | mr1020_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501576033 | NA | 5.47E-08 | mr1335_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501576033 | NA | 5.74E-06 | mr1355_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501576033 | NA | 6.10E-06 | mr1405_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501576033 | NA | 3.79E-06 | mr1462_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501576033 | 5.50E-06 | 5.50E-06 | mr1472_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501576033 | NA | 1.73E-09 | mr1506_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501576033 | NA | 3.07E-12 | mr1666_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501576033 | NA | 4.34E-20 | mr1712_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501576033 | NA | 2.65E-16 | mr1717_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501576033 | NA | 1.67E-08 | mr1749_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501576033 | NA | 1.60E-10 | mr1761_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501576033 | NA | 8.33E-08 | mr1765_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501576033 | NA | 4.76E-13 | mr1770_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501576033 | NA | 3.33E-09 | mr1821_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501576033 | NA | 2.04E-10 | mr1893_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501576033 | NA | 4.17E-06 | mr1899_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501576033 | NA | 1.44E-09 | mr1946_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501576033 | NA | 1.44E-09 | mr1948_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |