| Variant ID: vg0501533978 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 1533978 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TTTAAGGGTGTGTTTGTCACCCCTTCTTCCCAACCCCTCTCCCACATTTTCCGCACGCACACTTTTCAAACTGCTAAACGGTGTATTTTTTTTAAAAAAA[T/A]
TTCTATATGAAAGTTGCTTAAAAAACCAAATTAATCCATTTTTGAAAAAAATAGCTAACACTACTTAGTTAATCACACGCTAATGGACTGCTTCGTTTTC
GAAAACGAAGCAGTCCATTAGCGTGTGATTAACTAAGTAGTGTTAGCTATTTTTTTCAAAAATGGATTAATTTGGTTTTTTAAGCAACTTTCATATAGAA[A/T]
TTTTTTTAAAAAAAATACACCGTTTAGCAGTTTGAAAAGTGTGCGTGCGGAAAATGTGGGAGAGGGGTTGGGAAGAAGGGGTGACAAACACACCCTTAAA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.30% | 4.40% | 1.29% | 0.00% | NA |
| All Indica | 2759 | 90.40% | 7.40% | 2.14% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.10% | 1.50% | 1.34% | 0.00% | NA |
| Indica II | 465 | 74.60% | 19.80% | 5.59% | 0.00% | NA |
| Indica III | 913 | 97.80% | 1.80% | 0.44% | 0.00% | NA |
| Indica Intermediate | 786 | 86.10% | 11.20% | 2.67% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 2.20% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0501533978 | T -> A | LOC_Os05g03610.1 | upstream_gene_variant ; 1730.0bp to feature; MODIFIER | silent_mutation | Average:44.872; most accessible tissue: Zhenshan97 flag leaf, score: 74.825 | N | N | N | N |
| vg0501533978 | T -> A | LOC_Os05g03600.1 | downstream_gene_variant ; 4271.0bp to feature; MODIFIER | silent_mutation | Average:44.872; most accessible tissue: Zhenshan97 flag leaf, score: 74.825 | N | N | N | N |
| vg0501533978 | T -> A | LOC_Os05g03600-LOC_Os05g03610 | intergenic_region ; MODIFIER | silent_mutation | Average:44.872; most accessible tissue: Zhenshan97 flag leaf, score: 74.825 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0501533978 | NA | 6.81E-06 | mr1216 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501533978 | 5.00E-06 | 4.99E-06 | mr1340 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501533978 | 2.15E-06 | 2.14E-06 | mr1429 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501533978 | 5.13E-06 | 5.13E-06 | mr1487 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |