\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0501529875:

Variant ID: vg0501529875 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 1529875
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.51, C: 0.48, A: 0.01, others allele: 0.00, population size: 88. )

Flanking Sequence (100 bp) in Reference Genome:


ACCTGACAGGCACGACCACATAGGAGTTGGGAGGCATCTGCGTCGAGCATTCTCCTGCTGGTTGCCAAGGCAATCGGCAAGGGGCGACAGATGAGGGCTA[T/C]
GGCTAGCAAGCGGTAGCAACAGGCAGTGCATGTGTGTACTAACATCAAGCGACAAGCCAACAAGCAAAGGGCTGACCGACCGAGCAAAGTTGTTGCAGAT

Reverse complement sequence

ATCTGCAACAACTTTGCTCGGTCGGTCAGCCCTTTGCTTGTTGGCTTGTCGCTTGATGTTAGTACACACATGCACTGCCTGTTGCTACCGCTTGCTAGCC[A/G]
TAGCCCTCATCTGTCGCCCCTTGCCGATTGCCTTGGCAACCAGCAGGAGAATGCTCGACGCAGATGCCTCCCAACTCCTATGTGGTCGTGCCTGTCAGGT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 44.90% 42.90% 6.83% 5.33% NA
All Indica  2759 20.60% 59.60% 10.84% 9.06% NA
All Japonica  1512 96.00% 3.00% 0.93% 0.07% NA
Aus  269 1.90% 97.00% 1.12% 0.00% NA
Indica I  595 6.60% 48.10% 26.05% 19.33% NA
Indica II  465 37.80% 46.70% 5.81% 9.68% NA
Indica III  913 20.90% 73.20% 2.96% 2.96% NA
Indica Intermediate  786 20.50% 60.10% 11.45% 8.02% NA
Temperate Japonica  767 97.00% 1.40% 1.56% 0.00% NA
Tropical Japonica  504 94.80% 5.00% 0.20% 0.00% NA
Japonica Intermediate  241 95.00% 4.10% 0.41% 0.41% NA
VI/Aromatic  96 49.00% 51.00% 0.00% 0.00% NA
Intermediate  90 58.90% 32.20% 7.78% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0501529875 T -> DEL N N silent_mutation Average:59.694; most accessible tissue: Zhenshan97 panicle, score: 89.143 N N N N
vg0501529875 T -> C LOC_Os05g03600.1 downstream_gene_variant ; 168.0bp to feature; MODIFIER silent_mutation Average:59.694; most accessible tissue: Zhenshan97 panicle, score: 89.143 N N N N
vg0501529875 T -> C LOC_Os05g03600-LOC_Os05g03610 intergenic_region ; MODIFIER silent_mutation Average:59.694; most accessible tissue: Zhenshan97 panicle, score: 89.143 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0501529875 T C -0.02 -0.02 -0.02 -0.01 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0501529875 NA 7.09E-06 mr1035 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501529875 NA 1.44E-06 mr1170 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501529875 4.58E-06 4.58E-06 mr1429 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501529875 NA 3.05E-07 mr1453 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501529875 NA 5.39E-06 mr1500 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501529875 NA 1.77E-06 mr1626 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501529875 NA 2.95E-06 mr1631 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501529875 NA 1.59E-08 mr1662 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501529875 NA 1.57E-06 mr1679 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501529875 NA 1.61E-06 mr1720 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501529875 NA 4.25E-06 mr1749 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501529875 NA 3.89E-08 mr1806 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501529875 NA 3.39E-14 mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501529875 NA 5.74E-06 mr1355_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501529875 NA 3.61E-09 mr1660_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501529875 NA 1.72E-06 mr1662_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501529875 NA 6.85E-06 mr1977_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251