Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0501528934:

Variant ID: vg0501528934 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 1528934
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGGGTTATGTGAGTAGATTCATGGAGAAACCCACTACCGAGCATCTGGCAGCCGTGAAACGTGTGCTGCGCTATGTCGCCGGCACCATCAATCGCGGCTG[T/C]
AGCTACCGGAGGAAGAAAGGAGCTGTTCATCTAGTTGGATTCAGTGACAGCGATCTCGCCGGCGACGTCGACACGCGGAAAAGCACCACCGGTGTCTTCT

Reverse complement sequence

AGAAGACACCGGTGGTGCTTTTCCGCGTGTCGACGTCGCCGGCGAGATCGCTGTCACTGAATCCAACTAGATGAACAGCTCCTTTCTTCCTCCGGTAGCT[A/G]
CAGCCGCGATTGATGGTGCCGGCGACATAGCGCAGCACACGTTTCACGGCTGCCAGATGCTCGGTAGTGGGTTTCTCCATGAATCTACTCACATAACCCA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	28.60%	12.30%	23.70%	35.38%	NA
All Indica	2759	16.90%	3.50%	27.40%	52.19%	NA
All Japonica	1512	55.80%	30.90%	10.32%	2.98%	NA
Aus	269	2.20%	0.70%	64.68%	32.34%	NA
Indica I	595	7.70%	0.00%	7.90%	84.37%	NA
Indica II	465	37.40%	1.30%	20.86%	40.43%	NA
Indica III	913	10.40%	8.30%	46.66%	34.61%	NA
Indica Intermediate	786	19.30%	1.80%	23.66%	55.22%	NA
Temperate Japonica	767	91.70%	3.10%	4.04%	1.17%	NA
Tropical Japonica	504	7.50%	72.80%	14.68%	4.96%	NA
Japonica Intermediate	241	42.70%	31.50%	21.16%	4.56%	NA
VI/Aromatic	96	2.10%	1.00%	12.50%	84.38%	NA
Intermediate	90	37.80%	16.70%	24.44%	21.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0501528934	T -> DEL	LOC_Os05g03600.1	N	frameshift_variant	Average:7.341; most accessible tissue: Callus, score: 21.426	N	N	N	N
vg0501528934	T -> C	LOC_Os05g03600.1	synonymous_variant ; p.Cys1447Cys; LOW	synonymous_codon	Average:7.341; most accessible tissue: Callus, score: 21.426	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0501528934	NA	4.03E-06	mr1013	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501528934	NA	1.85E-06	mr1031	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501528934	NA	4.19E-06	mr1056	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501528934	NA	5.22E-06	mr1170	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501528934	NA	2.23E-06	mr1213	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501528934	NA	9.29E-06	mr1404	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501528934	7.11E-07	1.32E-15	mr1486	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501528934	NA	9.76E-09	mr1548	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501528934	NA	7.78E-10	mr1549	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501528934	NA	7.33E-10	mr1563	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501528934	NA	1.65E-06	mr1570	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501528934	NA	1.60E-06	mr1576	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501528934	NA	1.77E-07	mr1627	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501528934	NA	2.91E-08	mr1733	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501528934	NA	6.10E-06	mr1741	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501528934	NA	5.57E-11	mr1757	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501528934	NA	4.87E-10	mr1093_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501528934	NA	2.69E-06	mr1423_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501528934	NA	1.21E-12	mr1486_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501528934	NA	4.04E-08	mr1599_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501528934	NA	9.43E-06	mr1679_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501528934	NA	4.92E-08	mr1733_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251