| Variant ID: vg0501528934 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 1528934 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
TGGGTTATGTGAGTAGATTCATGGAGAAACCCACTACCGAGCATCTGGCAGCCGTGAAACGTGTGCTGCGCTATGTCGCCGGCACCATCAATCGCGGCTG[T/C]
AGCTACCGGAGGAAGAAAGGAGCTGTTCATCTAGTTGGATTCAGTGACAGCGATCTCGCCGGCGACGTCGACACGCGGAAAAGCACCACCGGTGTCTTCT
AGAAGACACCGGTGGTGCTTTTCCGCGTGTCGACGTCGCCGGCGAGATCGCTGTCACTGAATCCAACTAGATGAACAGCTCCTTTCTTCCTCCGGTAGCT[A/G]
CAGCCGCGATTGATGGTGCCGGCGACATAGCGCAGCACACGTTTCACGGCTGCCAGATGCTCGGTAGTGGGTTTCTCCATGAATCTACTCACATAACCCA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 28.60% | 12.30% | 23.70% | 35.38% | NA |
| All Indica | 2759 | 16.90% | 3.50% | 27.40% | 52.19% | NA |
| All Japonica | 1512 | 55.80% | 30.90% | 10.32% | 2.98% | NA |
| Aus | 269 | 2.20% | 0.70% | 64.68% | 32.34% | NA |
| Indica I | 595 | 7.70% | 0.00% | 7.90% | 84.37% | NA |
| Indica II | 465 | 37.40% | 1.30% | 20.86% | 40.43% | NA |
| Indica III | 913 | 10.40% | 8.30% | 46.66% | 34.61% | NA |
| Indica Intermediate | 786 | 19.30% | 1.80% | 23.66% | 55.22% | NA |
| Temperate Japonica | 767 | 91.70% | 3.10% | 4.04% | 1.17% | NA |
| Tropical Japonica | 504 | 7.50% | 72.80% | 14.68% | 4.96% | NA |
| Japonica Intermediate | 241 | 42.70% | 31.50% | 21.16% | 4.56% | NA |
| VI/Aromatic | 96 | 2.10% | 1.00% | 12.50% | 84.38% | NA |
| Intermediate | 90 | 37.80% | 16.70% | 24.44% | 21.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0501528934 | T -> DEL | LOC_Os05g03600.1 | N | frameshift_variant | Average:7.341; most accessible tissue: Callus, score: 21.426 | N | N | N | N |
| vg0501528934 | T -> C | LOC_Os05g03600.1 | synonymous_variant ; p.Cys1447Cys; LOW | synonymous_codon | Average:7.341; most accessible tissue: Callus, score: 21.426 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0501528934 | NA | 4.03E-06 | mr1013 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501528934 | NA | 1.85E-06 | mr1031 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501528934 | NA | 4.19E-06 | mr1056 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501528934 | NA | 5.22E-06 | mr1170 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501528934 | NA | 2.23E-06 | mr1213 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501528934 | NA | 9.29E-06 | mr1404 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501528934 | 7.11E-07 | 1.32E-15 | mr1486 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501528934 | NA | 9.76E-09 | mr1548 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501528934 | NA | 7.78E-10 | mr1549 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501528934 | NA | 7.33E-10 | mr1563 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/