\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0501493417:

Variant ID: vg0501493417 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 1493417
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.75, T: 0.25, others allele: 0.00, population size: 159. )

Flanking Sequence (100 bp) in Reference Genome:


AAGCTAATATTGCTTGATGCACTTGTGAAGAAACTAAAGGCATTTGCCTGTGCCTCCTCCTTATCCTTGCAAGCCCAAGAATCCCAATTTCATTTTTTTT[C/T]
CCTTCATGGTTAAGCATCAGGATGGAGGCTAAGGCATCCACACTAGCCAACAATCACACACCATAATTGTATTATTCTAGTGCTTTATCACACAGAATCA

Reverse complement sequence

TGATTCTGTGTGATAAAGCACTAGAATAATACAATTATGGTGTGTGATTGTTGGCTAGTGTGGATGCCTTAGCCTCCATCCTGATGCTTAACCATGAAGG[G/A]
AAAAAAAATGAAATTGGGATTCTTGGGCTTGCAAGGATAAGGAGGAGGCACAGGCAAATGCCTTTAGTTTCTTCACAAGTGCATCAAGCAATATTAGCTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.40% 44.30% 0.30% 0.00% NA
All Indica  2759 80.00% 19.60% 0.43% 0.00% NA
All Japonica  1512 4.20% 95.80% 0.00% 0.00% NA
Aus  269 97.40% 2.60% 0.00% 0.00% NA
Indica I  595 94.50% 5.40% 0.17% 0.00% NA
Indica II  465 63.20% 36.30% 0.43% 0.00% NA
Indica III  913 78.60% 21.40% 0.00% 0.00% NA
Indica Intermediate  786 80.40% 18.40% 1.15% 0.00% NA
Temperate Japonica  767 3.10% 96.90% 0.00% 0.00% NA
Tropical Japonica  504 4.80% 95.20% 0.00% 0.00% NA
Japonica Intermediate  241 6.20% 93.80% 0.00% 0.00% NA
VI/Aromatic  96 52.10% 46.90% 1.04% 0.00% NA
Intermediate  90 40.00% 58.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0501493417 C -> T LOC_Os05g03530.1 upstream_gene_variant ; 557.0bp to feature; MODIFIER silent_mutation Average:65.203; most accessible tissue: Minghui63 root, score: 94.189 N N N N
vg0501493417 C -> T LOC_Os05g03530.3 upstream_gene_variant ; 557.0bp to feature; MODIFIER silent_mutation Average:65.203; most accessible tissue: Minghui63 root, score: 94.189 N N N N
vg0501493417 C -> T LOC_Os05g03530.2 upstream_gene_variant ; 557.0bp to feature; MODIFIER silent_mutation Average:65.203; most accessible tissue: Minghui63 root, score: 94.189 N N N N
vg0501493417 C -> T LOC_Os05g03520.1 downstream_gene_variant ; 2378.0bp to feature; MODIFIER silent_mutation Average:65.203; most accessible tissue: Minghui63 root, score: 94.189 N N N N
vg0501493417 C -> T LOC_Os05g03540.1 downstream_gene_variant ; 4439.0bp to feature; MODIFIER silent_mutation Average:65.203; most accessible tissue: Minghui63 root, score: 94.189 N N N N
vg0501493417 C -> T LOC_Os05g03520-LOC_Os05g03530 intergenic_region ; MODIFIER silent_mutation Average:65.203; most accessible tissue: Minghui63 root, score: 94.189 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0501493417 C T 0.13 0.05 -0.01 -0.01 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0501493417 NA 2.04E-06 mr1028 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501493417 NA 1.37E-22 mr1150 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501493417 NA 1.54E-06 mr1170 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501493417 NA 9.51E-10 mr1275 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501493417 NA 6.74E-07 mr1369 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501493417 NA 3.13E-06 mr1397 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501493417 NA 1.30E-07 mr1453 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501493417 NA 4.52E-09 mr1514 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501493417 NA 5.72E-06 mr1626 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501493417 NA 9.74E-06 mr1631 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501493417 NA 5.24E-09 mr1660 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501493417 NA 1.41E-06 mr1662 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501493417 NA 7.11E-06 mr1755 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501493417 NA 1.57E-08 mr1986 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501493417 NA 2.72E-13 mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501493417 NA 8.55E-06 mr1355_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501493417 NA 1.96E-08 mr1478_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501493417 NA 4.82E-12 mr1660_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501493417 NA 8.24E-06 mr1660_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501493417 NA 4.72E-14 mr1904_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501493417 NA 8.94E-07 mr1977_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251