\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0501482241:

Variant ID: vg0501482241 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 1482241
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.78, T: 0.22, others allele: 0.00, population size: 88. )

Flanking Sequence (100 bp) in Reference Genome:


TGAAACCACCGCGCCGTGCATCTCACCGGCAGACCACCGCCGTCGCCGGGCTCACGCCGCGGTCCTTCTCCGGCGCCCAACTCCTTCCCCGCCTCCACTT[T/C]
GACAGCAGTCGTGACGGTCGCCTCCACAGCCACAGTTCTCCCTCCTCGTTGCCTCCCCGCAACCTCGCCACCGCTGCCGTCTCCGCACGGTCGCGCCACC

Reverse complement sequence

GGTGGCGCGACCGTGCGGAGACGGCAGCGGTGGCGAGGTTGCGGGGAGGCAACGAGGAGGGAGAACTGTGGCTGTGGAGGCGACCGTCACGACTGCTGTC[A/G]
AAGTGGAGGCGGGGAAGGAGTTGGGCGCCGGAGAAGGACCGCGGCGTGAGCCCGGCGACGGCGGTGGTCTGCCGGTGAGATGCACGGCGCGGTGGTTTCA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 44.50% 33.70% 15.34% 6.41% NA
All Indica  2759 41.80% 22.20% 25.23% 10.80% NA
All Japonica  1512 52.20% 47.20% 0.60% 0.00% NA
Aus  269 41.60% 53.50% 3.72% 1.12% NA
Indica I  595 27.70% 5.70% 51.26% 15.29% NA
Indica II  465 61.30% 11.00% 20.86% 6.88% NA
Indica III  913 37.00% 42.70% 10.19% 10.08% NA
Indica Intermediate  786 46.40% 17.40% 25.57% 10.56% NA
Temperate Japonica  767 88.90% 10.20% 0.91% 0.00% NA
Tropical Japonica  504 4.80% 95.00% 0.20% 0.00% NA
Japonica Intermediate  241 34.40% 65.10% 0.41% 0.00% NA
VI/Aromatic  96 8.30% 89.60% 2.08% 0.00% NA
Intermediate  90 45.60% 43.30% 8.89% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0501482241 T -> DEL LOC_Os05g03500.1 N frameshift_variant Average:77.639; most accessible tissue: Minghui63 panicle, score: 98.282 N N N N
vg0501482241 T -> C LOC_Os05g03500.1 synonymous_variant ; p.Ser150Ser; LOW synonymous_codon Average:77.639; most accessible tissue: Minghui63 panicle, score: 98.282 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0501482241 T C 0.06 0.02 0.05 0.02 0.06 0.08

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0501482241 NA 1.56E-06 mr1029 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501482241 NA 3.87E-09 mr1047 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501482241 NA 1.23E-10 mr1084 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501482241 NA 2.75E-06 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501482241 NA 6.82E-08 mr1220 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501482241 NA 1.41E-06 mr1338 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501482241 5.65E-06 NA mr1486 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501482241 NA 3.90E-13 mr1486 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501482241 NA 1.14E-07 mr1548 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501482241 NA 8.79E-10 mr1549 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501482241 NA 2.63E-10 mr1563 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501482241 NA 4.63E-08 mr1570 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501482241 NA 3.62E-08 mr1570 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501482241 NA 3.96E-06 mr1576 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501482241 NA 3.08E-06 mr1625 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501482241 NA 1.22E-06 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501482241 NA 1.42E-07 mr1668 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501482241 NA 4.62E-07 mr1723 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501482241 NA 2.90E-06 mr1725 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501482241 NA 4.76E-08 mr1733 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501482241 NA 1.48E-06 mr1734 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501482241 NA 6.47E-06 mr1741 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501482241 NA 6.16E-10 mr1757 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501482241 NA 6.20E-06 mr1161_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501482241 NA 9.41E-11 mr1486_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501482241 NA 6.23E-08 mr1733_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251