Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0501459510:

Variant ID: vg0501459510 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 1459510
Reference Allele: GAlternative Allele: A,C
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.05, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


TTTGGATTTTGATTGAAATTGGAGATGATGTGACTAAAAAGTTACGTGTCTATAATAGGTTGATATGATGGAAAAGAACTGAAGTTTGGATCCAAACTTT[G/A,C]
TATCTAAACACAGCCTAAGTTCATGGATTATATGGTACAGCACCCACAACCCCACATCACATGTTGAGGTTGCTGACACGAGAGGACCATAATTTGGGCC

Reverse complement sequence

GGCCCAAATTATGGTCCTCTCGTGTCAGCAACCTCAACATGTGATGTGGGGTTGTGGGTGCTGTACCATATAATCCATGAACTTAGGCTGTGTTTAGATA[C/T,G]
AAAGTTTGGATCCAAACTTCAGTTCTTTTCCATCATATCAACCTATTATAGACACGTAACTTTTTAGTCACATCATCTCCAATTTCAATCAAAATCCAAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 47.40% 21.80% 12.38% 17.35% C: 1.06%
All Indica  2759 24.50% 29.90% 16.67% 28.78% C: 0.11%
All Japonica  1512 94.70% 2.70% 2.05% 0.20% C: 0.33%
Aus  269 11.90% 53.20% 30.48% 4.46% NA
Indica I  595 12.60% 24.70% 30.76% 31.93% NA
Indica II  465 41.90% 11.40% 12.69% 33.98% NA
Indica III  913 23.90% 46.70% 8.54% 20.81% C: 0.11%
Indica Intermediate  786 24.00% 25.30% 17.81% 32.57% C: 0.25%
Temperate Japonica  767 94.00% 4.70% 1.17% 0.00% C: 0.13%
Tropical Japonica  504 95.60% 0.60% 3.77% 0.00% NA
Japonica Intermediate  241 95.00% 0.80% 1.24% 1.24% C: 1.66%
VI/Aromatic  96 40.60% 9.40% 7.29% 1.04% C: 41.67%
Intermediate  90 68.90% 12.20% 5.56% 11.11% C: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0501459510 G -> DEL N N silent_mutation Average:70.132; most accessible tissue: Zhenshan97 panicle, score: 91.992 N N N N
vg0501459510 G -> C LOC_Os05g03460.1 upstream_gene_variant ; 1852.0bp to feature; MODIFIER silent_mutation Average:70.132; most accessible tissue: Zhenshan97 panicle, score: 91.992 N N N N
vg0501459510 G -> C LOC_Os05g03450.1 downstream_gene_variant ; 2190.0bp to feature; MODIFIER silent_mutation Average:70.132; most accessible tissue: Zhenshan97 panicle, score: 91.992 N N N N
vg0501459510 G -> C LOC_Os05g03450-LOC_Os05g03460 intergenic_region ; MODIFIER silent_mutation Average:70.132; most accessible tissue: Zhenshan97 panicle, score: 91.992 N N N N
vg0501459510 G -> A LOC_Os05g03460.1 upstream_gene_variant ; 1852.0bp to feature; MODIFIER silent_mutation Average:70.132; most accessible tissue: Zhenshan97 panicle, score: 91.992 N N N N
vg0501459510 G -> A LOC_Os05g03450.1 downstream_gene_variant ; 2190.0bp to feature; MODIFIER silent_mutation Average:70.132; most accessible tissue: Zhenshan97 panicle, score: 91.992 N N N N
vg0501459510 G -> A LOC_Os05g03450-LOC_Os05g03460 intergenic_region ; MODIFIER silent_mutation Average:70.132; most accessible tissue: Zhenshan97 panicle, score: 91.992 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0501459510 G A 0.03 0.02 0.01 0.01 0.0 0.01
vg0501459510 G C 0.02 0.04 0.02 0.01 0.03 0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0501459510 3.88E-08 4.48E-16 Awn_length Jap_All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0501459510 NA 3.38E-06 mr1201 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501459510 NA 4.01E-06 mr1219 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501459510 NA 2.69E-06 mr1219_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501459510 NA 6.00E-06 mr1274_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251