\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0501424855:

Variant ID: vg0501424855 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 1424855
Reference Allele: CAlternative Allele: A
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAGTTTTTTTTTGTTTTCCAAAATTTATCTTTGCCTGACGGTTGTCTTAACCGGCCACCTGTAAAAATCGTATTTTCGCAGATGGCTGTCTTAACCTAAC[C/A]
GCTGGCATAAACGATTTTCGCTGGCGCATCCGCCAGTGAAAATTATGTATCACTAGCGGTTGATGGCCGCTAGTGAAGATGGTGTATTTTCACTTGCCAT

Reverse complement sequence

ATGGCAAGTGAAAATACACCATCTTCACTAGCGGCCATCAACCGCTAGTGATACATAATTTTCACTGGCGGATGCGCCAGCGAAAATCGTTTATGCCAGC[G/T]
GTTAGGTTAAGACAGCCATCTGCGAAAATACGATTTTTACAGGTGGCCGGTTAAGACAACCGTCAGGCAAAGATAAATTTTGGAAAACAAAAAAAAACTC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.70% 40.20% 0.17% 0.00% NA
All Indica  2759 86.50% 13.20% 0.25% 0.00% NA
All Japonica  1512 4.60% 95.40% 0.00% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 96.10% 3.90% 0.00% 0.00% NA
Indica II  465 84.90% 15.10% 0.00% 0.00% NA
Indica III  913 79.80% 19.90% 0.22% 0.00% NA
Indica Intermediate  786 87.90% 11.50% 0.64% 0.00% NA
Temperate Japonica  767 3.90% 96.10% 0.00% 0.00% NA
Tropical Japonica  504 5.00% 95.00% 0.00% 0.00% NA
Japonica Intermediate  241 5.80% 94.20% 0.00% 0.00% NA
VI/Aromatic  96 61.50% 38.50% 0.00% 0.00% NA
Intermediate  90 42.20% 56.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0501424855 C -> A LOC_Os05g03410.1 upstream_gene_variant ; 3441.0bp to feature; MODIFIER silent_mutation Average:63.876; most accessible tissue: Minghui63 root, score: 85.36 N N N N
vg0501424855 C -> A LOC_Os05g03430.1 upstream_gene_variant ; 2074.0bp to feature; MODIFIER silent_mutation Average:63.876; most accessible tissue: Minghui63 root, score: 85.36 N N N N
vg0501424855 C -> A LOC_Os05g03430.2 upstream_gene_variant ; 2074.0bp to feature; MODIFIER silent_mutation Average:63.876; most accessible tissue: Minghui63 root, score: 85.36 N N N N
vg0501424855 C -> A LOC_Os05g03430.3 upstream_gene_variant ; 3809.0bp to feature; MODIFIER silent_mutation Average:63.876; most accessible tissue: Minghui63 root, score: 85.36 N N N N
vg0501424855 C -> A LOC_Os05g03420.1 downstream_gene_variant ; 941.0bp to feature; MODIFIER silent_mutation Average:63.876; most accessible tissue: Minghui63 root, score: 85.36 N N N N
vg0501424855 C -> A LOC_Os05g03420-LOC_Os05g03430 intergenic_region ; MODIFIER silent_mutation Average:63.876; most accessible tissue: Minghui63 root, score: 85.36 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0501424855 C A -0.03 -0.03 -0.03 -0.03 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0501424855 NA 8.40E-06 mr1034 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501424855 NA 2.38E-06 mr1035 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501424855 NA 6.79E-07 mr1420 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501424855 1.01E-06 1.01E-06 mr1497 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501424855 NA 6.31E-06 mr1577 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501424855 5.70E-06 2.63E-08 mr1626 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501424855 NA 9.27E-08 mr1660 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501424855 NA 4.32E-06 mr1679 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501424855 NA 1.44E-06 mr1720 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501424855 NA 5.57E-06 mr1772 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501424855 NA 2.17E-06 mr1772 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501424855 NA 5.84E-09 mr1776 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501424855 NA 1.71E-08 mr1806 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501424855 NA 5.14E-07 mr1870 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501424855 NA 1.06E-18 mr1168_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501424855 NA 7.53E-14 mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501424855 NA 3.88E-06 mr1355_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501424855 NA 1.55E-09 mr1576_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501424855 NA 8.96E-09 mr1660_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501424855 NA 2.68E-17 mr1712_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251