\
| Variant ID: vg0501421653 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 1421653 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TTCATGTACACATATAGTTTTACATATTTCACAAAATTTTTTAATAAGACGAACGGTCAAACATGTGCTAAAAAATCAACGGTGTCAAACATTTTGAAAC[A/G]
GAGGGAGTAATTTGTAAACTGTAAATAATAAGACGGTGGTACTACAAGGTGCAGCAAATTAAAATAGTATTTGCGCCAAGGAACGACAGAATATACGATA
TATCGTATATTCTGTCGTTCCTTGGCGCAAATACTATTTTAATTTGCTGCACCTTGTAGTACCACCGTCTTATTATTTACAGTTTACAAATTACTCCCTC[T/C]
GTTTCAAAATGTTTGACACCGTTGATTTTTTAGCACATGTTTGACCGTTCGTCTTATTAAAAAATTTTGTGAAATATGTAAAACTATATGTGTACATGAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 59.80% | 40.10% | 0.08% | 0.00% | NA |
| All Indica | 2759 | 86.60% | 13.30% | 0.14% | 0.00% | NA |
| All Japonica | 1512 | 4.60% | 95.40% | 0.00% | 0.00% | NA |
| Aus | 269 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 96.10% | 3.90% | 0.00% | 0.00% | NA |
| Indica II | 465 | 85.20% | 14.80% | 0.00% | 0.00% | NA |
| Indica III | 913 | 79.80% | 19.90% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 88.00% | 11.70% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 3.90% | 96.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 5.00% | 95.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 5.80% | 94.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 63.50% | 36.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 45.60% | 54.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0501421653 | A -> G | LOC_Os05g03410.1 | upstream_gene_variant ; 239.0bp to feature; MODIFIER | silent_mutation | Average:26.879; most accessible tissue: Zhenshan97 panicle, score: 65.386 | N | N | N | N |
| vg0501421653 | A -> G | LOC_Os05g03420.1 | upstream_gene_variant ; 489.0bp to feature; MODIFIER | silent_mutation | Average:26.879; most accessible tissue: Zhenshan97 panicle, score: 65.386 | N | N | N | N |
| vg0501421653 | A -> G | LOC_Os05g03410-LOC_Os05g03420 | intergenic_region ; MODIFIER | silent_mutation | Average:26.879; most accessible tissue: Zhenshan97 panicle, score: 65.386 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0501421653 | NA | 3.96E-07 | mr1913 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501421653 | 8.53E-06 | 8.53E-06 | mr1024_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501421653 | NA | 7.84E-07 | mr1057_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501421653 | NA | 2.53E-06 | mr1117_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501421653 | NA | 7.29E-07 | mr1119_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501421653 | NA | 1.66E-06 | mr1169_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501421653 | NA | 6.72E-06 | mr1232_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501421653 | NA | 2.76E-12 | mr1612_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501421653 | NA | 4.89E-07 | mr1842_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |