Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0501421653:

Variant ID: vg0501421653 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 1421653
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTCATGTACACATATAGTTTTACATATTTCACAAAATTTTTTAATAAGACGAACGGTCAAACATGTGCTAAAAAATCAACGGTGTCAAACATTTTGAAAC[A/G]
GAGGGAGTAATTTGTAAACTGTAAATAATAAGACGGTGGTACTACAAGGTGCAGCAAATTAAAATAGTATTTGCGCCAAGGAACGACAGAATATACGATA

Reverse complement sequence

TATCGTATATTCTGTCGTTCCTTGGCGCAAATACTATTTTAATTTGCTGCACCTTGTAGTACCACCGTCTTATTATTTACAGTTTACAAATTACTCCCTC[T/C]
GTTTCAAAATGTTTGACACCGTTGATTTTTTAGCACATGTTTGACCGTTCGTCTTATTAAAAAATTTTGTGAAATATGTAAAACTATATGTGTACATGAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	59.80%	40.10%	0.08%	0.00%	NA
All Indica	2759	86.60%	13.30%	0.14%	0.00%	NA
All Japonica	1512	4.60%	95.40%	0.00%	0.00%	NA
Aus	269	98.90%	1.10%	0.00%	0.00%	NA
Indica I	595	96.10%	3.90%	0.00%	0.00%	NA
Indica II	465	85.20%	14.80%	0.00%	0.00%	NA
Indica III	913	79.80%	19.90%	0.22%	0.00%	NA
Indica Intermediate	786	88.00%	11.70%	0.25%	0.00%	NA
Temperate Japonica	767	3.90%	96.10%	0.00%	0.00%	NA
Tropical Japonica	504	5.00%	95.00%	0.00%	0.00%	NA
Japonica Intermediate	241	5.80%	94.20%	0.00%	0.00%	NA
VI/Aromatic	96	63.50%	36.50%	0.00%	0.00%	NA
Intermediate	90	45.60%	54.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0501421653	A -> G	LOC_Os05g03410.1	upstream_gene_variant ; 239.0bp to feature; MODIFIER	silent_mutation	Average:26.879; most accessible tissue: Zhenshan97 panicle, score: 65.386	N	N	N	N
vg0501421653	A -> G	LOC_Os05g03420.1	upstream_gene_variant ; 489.0bp to feature; MODIFIER	silent_mutation	Average:26.879; most accessible tissue: Zhenshan97 panicle, score: 65.386	N	N	N	N
vg0501421653	A -> G	LOC_Os05g03410-LOC_Os05g03420	intergenic_region ; MODIFIER	silent_mutation	Average:26.879; most accessible tissue: Zhenshan97 panicle, score: 65.386	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0501421653	NA	3.96E-07	mr1913	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501421653	8.53E-06	8.53E-06	mr1024_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501421653	NA	7.84E-07	mr1057_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501421653	NA	2.53E-06	mr1117_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501421653	NA	7.29E-07	mr1119_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501421653	NA	1.66E-06	mr1169_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501421653	NA	6.72E-06	mr1232_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501421653	NA	2.76E-12	mr1612_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501421653	NA	4.89E-07	mr1842_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251