\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0501421653:

Variant ID: vg0501421653 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 1421653
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTCATGTACACATATAGTTTTACATATTTCACAAAATTTTTTAATAAGACGAACGGTCAAACATGTGCTAAAAAATCAACGGTGTCAAACATTTTGAAAC[A/G]
GAGGGAGTAATTTGTAAACTGTAAATAATAAGACGGTGGTACTACAAGGTGCAGCAAATTAAAATAGTATTTGCGCCAAGGAACGACAGAATATACGATA

Reverse complement sequence

TATCGTATATTCTGTCGTTCCTTGGCGCAAATACTATTTTAATTTGCTGCACCTTGTAGTACCACCGTCTTATTATTTACAGTTTACAAATTACTCCCTC[T/C]
GTTTCAAAATGTTTGACACCGTTGATTTTTTAGCACATGTTTGACCGTTCGTCTTATTAAAAAATTTTGTGAAATATGTAAAACTATATGTGTACATGAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.80% 40.10% 0.08% 0.00% NA
All Indica  2759 86.60% 13.30% 0.14% 0.00% NA
All Japonica  1512 4.60% 95.40% 0.00% 0.00% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 96.10% 3.90% 0.00% 0.00% NA
Indica II  465 85.20% 14.80% 0.00% 0.00% NA
Indica III  913 79.80% 19.90% 0.22% 0.00% NA
Indica Intermediate  786 88.00% 11.70% 0.25% 0.00% NA
Temperate Japonica  767 3.90% 96.10% 0.00% 0.00% NA
Tropical Japonica  504 5.00% 95.00% 0.00% 0.00% NA
Japonica Intermediate  241 5.80% 94.20% 0.00% 0.00% NA
VI/Aromatic  96 63.50% 36.50% 0.00% 0.00% NA
Intermediate  90 45.60% 54.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0501421653 A -> G LOC_Os05g03410.1 upstream_gene_variant ; 239.0bp to feature; MODIFIER silent_mutation Average:26.879; most accessible tissue: Zhenshan97 panicle, score: 65.386 N N N N
vg0501421653 A -> G LOC_Os05g03420.1 upstream_gene_variant ; 489.0bp to feature; MODIFIER silent_mutation Average:26.879; most accessible tissue: Zhenshan97 panicle, score: 65.386 N N N N
vg0501421653 A -> G LOC_Os05g03410-LOC_Os05g03420 intergenic_region ; MODIFIER silent_mutation Average:26.879; most accessible tissue: Zhenshan97 panicle, score: 65.386 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0501421653 NA 3.96E-07 mr1913 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501421653 8.53E-06 8.53E-06 mr1024_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501421653 NA 7.84E-07 mr1057_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501421653 NA 2.53E-06 mr1117_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501421653 NA 7.29E-07 mr1119_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501421653 NA 1.66E-06 mr1169_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501421653 NA 6.72E-06 mr1232_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501421653 NA 2.76E-12 mr1612_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501421653 NA 4.89E-07 mr1842_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251