Search for Variation information by Variation ID:
Detailed information for vg0501379198:
| Variant ID: vg0501379198 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 1379198 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
Flanking Sequence (100 bp) in Reference Genome:
CGGTGGGGTCTGGGCTCGTGAGGACGCGAGCCGTGAGAGTTCGTCGGCAATCATGTTATCCCGTCTGGGCACATGCCGAAGCTCGACCCCGTCGAAATGA[C/T]
GCTCCATACGCCGTATTTGGCGTACGTAAGCCTCCATCTGCGGGTCAGAGCACCGGTACTCCTTACAGACTTGGTTAACGACCAGCTGGGAGTCGCCTAA
Reverse complement sequence
TTAGGCGACTCCCAGCTGGTCGTTAACCAAGTCTGTAAGGAGTACCGGTGCTCTGACCCGCAGATGGAGGCTTACGTACGCCAAATACGGCGTATGGAGC[G/A]
TCATTTCGACGGGGTCGAGCTTCGGCATGTGCCCAGACGGGATAACATGATTGCCGACGAACTCTCACGGCTCGCGTCCTCACGAGCCCAGACCCCACCG
Allele Frequencies:
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.00% | 4.70% | 0.30% | 0.00% | NA |
| All Indica | 2759 | 98.40% | 1.20% | 0.40% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.07% | 0.00% | NA |
| Aus | 269 | 33.10% | 66.20% | 0.74% | 0.00% | NA |
| Indica I | 595 | 98.80% | 0.80% | 0.34% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.20% | 0.22% | 0.00% | NA |
| Indica III | 913 | 98.50% | 1.40% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 97.30% | 1.80% | 0.89% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.00% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 7.80% | 0.00% | 0.00% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0501379198 | C -> T | LOC_Os05g03360.1 | missense_variant ; p.Arg1534His; MODERATE | nonsynonymous_codon ; R1534H | Average:38.928; most accessible tissue: Minghui63 young leaf, score: 65.161 | benign  |
0.862 |
DELETERIOUS | 0.03 |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0501379198 | NA | 1.82E-15 | mr1113 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501379198 | 1.06E-07 | 2.46E-21 | mr1114 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501379198 | NA | 3.52E-24 | mr1123 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501379198 | 6.55E-09 | 7.44E-22 | mr1242 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501379198 | NA | 1.06E-08 | mr1348 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501379198 | NA | 7.64E-07 | mr1415 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501379198 | 3.98E-06 | 1.77E-16 | mr1496 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501379198 | NA | 7.64E-07 | mr1567 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501379198 | NA | 5.46E-06 | mr1621 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501379198 | NA | 7.93E-07 | mr1931 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |