\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0501368194:

Variant ID: vg0501368194 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 1368194
Reference Allele: TAlternative Allele: G
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, G: 0.01, others allele: 0.00, population size: 111. )

Flanking Sequence (100 bp) in Reference Genome:


AAATACCGATAATAAAAGGGGACACAAAATGAAATTTACTCTCAAATCTATTAAAAAATACTGAAATTTCATATATAATATGAAACTATGAAAGAAATGT[T/G]
GTGAAATATGGTCTAAATTCAAGAAGTTTCATATGTTTTACTCATAATTTACAGGATTTTCCTTCAATTATATGCAACCTAGCTAGTGCAAAGTGAAACT

Reverse complement sequence

AGTTTCACTTTGCACTAGCTAGGTTGCATATAATTGAAGGAAAATCCTGTAAATTATGAGTAAAACATATGAAACTTCTTGAATTTAGACCATATTTCAC[A/C]
ACATTTCTTTCATAGTTTCATATTATATATGAAATTTCAGTATTTTTTAATAGATTTGAGAGTAAATTTCATTTTGTGTCCCCTTTTATTATCGGTATTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.00% 12.30% 0.85% 3.85% NA
All Indica  2759 79.60% 19.90% 0.11% 0.40% NA
All Japonica  1512 90.50% 1.90% 0.26% 7.34% NA
Aus  269 72.50% 0.00% 8.18% 19.33% NA
Indica I  595 94.10% 5.90% 0.00% 0.00% NA
Indica II  465 83.70% 15.50% 0.22% 0.65% NA
Indica III  913 66.50% 33.10% 0.00% 0.44% NA
Indica Intermediate  786 81.60% 17.70% 0.25% 0.51% NA
Temperate Japonica  767 96.20% 2.70% 0.26% 0.78% NA
Tropical Japonica  504 87.10% 0.80% 0.20% 11.90% NA
Japonica Intermediate  241 79.70% 1.20% 0.41% 18.67% NA
VI/Aromatic  96 84.40% 0.00% 11.46% 4.17% NA
Intermediate  90 91.10% 4.40% 0.00% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0501368194 T -> DEL N N silent_mutation Average:20.082; most accessible tissue: Minghui63 young leaf, score: 49.581 N N N N
vg0501368194 T -> G LOC_Os05g03339.1 downstream_gene_variant ; 2577.0bp to feature; MODIFIER silent_mutation Average:20.082; most accessible tissue: Minghui63 young leaf, score: 49.581 N N N N
vg0501368194 T -> G LOC_Os05g03339-LOC_Os05g03350 intergenic_region ; MODIFIER silent_mutation Average:20.082; most accessible tissue: Minghui63 young leaf, score: 49.581 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0501368194 NA 4.37E-06 mr1006 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501368194 NA 6.22E-06 mr1136 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501368194 NA 4.06E-09 mr1870 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501368194 NA 1.65E-06 mr1870_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251