Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0501367936:

Variant ID: vg0501367936 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 1367936
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.77, G: 0.23, others allele: 0.00, population size: 154. )

Flanking Sequence (100 bp) in Reference Genome:

TGTTTTTAATTTGGACCGGGTAAATTTACAATTGTGTTACTTTGGACTACCCTCAACTCTCTTATTCATCTACATTCAATTTGTCATATGTTAAAGAAAC[A/G]
ATCTAAATACAGCTAAGGAGGTTTATTGACGAATATGAGCTGGCTTACTCGAGGTCGTTCATATGCTTGAGAGGAGAGTCAGGGTGGTCCAAAGTGAAAC

Reverse complement sequence

GTTTCACTTTGGACCACCCTGACTCTCCTCTCAAGCATATGAACGACCTCGAGTAAGCCAGCTCATATTCGTCAATAAACCTCCTTAGCTGTATTTAGAT[T/C]
GTTTCTTTAACATATGACAAATTGAATGTAGATGAATAAGAGAGTTGAGGGTAGTCCAAAGTAACACAATTGTAAATTTACCCGGTCCAAATTAAAAACA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	47.70%	20.90%	2.67%	28.71%	NA
All Indica	2759	26.60%	28.50%	2.32%	42.59%	NA
All Japonica	1512	91.30%	0.20%	0.93%	7.54%	NA
Aus	269	2.60%	66.90%	13.75%	16.73%	NA
Indica I	595	8.20%	21.00%	2.35%	68.40%	NA
Indica II	465	21.50%	19.60%	2.58%	56.34%	NA
Indica III	913	44.80%	39.20%	1.97%	14.02%	NA
Indica Intermediate	786	22.40%	27.00%	2.54%	48.09%	NA
Temperate Japonica	767	98.80%	0.00%	0.00%	1.17%	NA
Tropical Japonica	504	86.50%	0.20%	2.38%	10.91%	NA
Japonica Intermediate	241	77.60%	0.80%	0.83%	20.75%	NA
VI/Aromatic	96	77.10%	4.20%	9.38%	9.38%	NA
Intermediate	90	64.40%	17.80%	2.22%	15.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0501367936	A -> DEL	N	N	silent_mutation	Average:21.831; most accessible tissue: Minghui63 young leaf, score: 70.655	N	N	N	N
vg0501367936	A -> G	LOC_Os05g03339.1	downstream_gene_variant ; 2319.0bp to feature; MODIFIER	silent_mutation	Average:21.831; most accessible tissue: Minghui63 young leaf, score: 70.655	N	N	N	N
vg0501367936	A -> G	LOC_Os05g03339-LOC_Os05g03350	intergenic_region ; MODIFIER	silent_mutation	Average:21.831; most accessible tissue: Minghui63 young leaf, score: 70.655	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0501367936	NA	7.75E-06	mr1035	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501367936	NA	8.80E-06	mr1136	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501367936	NA	1.08E-20	mr1254	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501367936	NA	1.92E-09	mr1275	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501367936	NA	1.98E-10	mr1302	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501367936	NA	1.17E-11	mr1307	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501367936	NA	5.06E-08	mr1315	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501367936	NA	9.75E-13	mr1335	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501367936	NA	5.92E-08	mr1392	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501367936	NA	3.43E-06	mr1397	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501367936	NA	8.03E-09	mr1420	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501367936	2.25E-06	2.25E-06	mr1420	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501367936	NA	1.63E-08	mr1439	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501367936	NA	5.60E-06	mr1439	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501367936	NA	9.32E-06	mr1450	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501367936	NA	7.83E-06	mr1461	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501367936	NA	1.25E-08	mr1488	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501367936	7.81E-06	7.79E-06	mr1497	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501367936	8.34E-06	8.34E-06	mr1497	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501367936	NA	3.30E-08	mr1506	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501367936	NA	7.54E-06	mr1511	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501367936	NA	1.39E-08	mr1604	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501367936	NA	6.47E-07	mr1626	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501367936	NA	7.67E-06	mr1630	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501367936	NA	1.05E-08	mr1660	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501367936	NA	6.23E-08	mr1680	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501367936	NA	8.10E-06	mr1733	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501367936	NA	2.69E-08	mr1764	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501367936	NA	7.48E-06	mr1772	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501367936	NA	1.69E-10	mr1776	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501367936	NA	3.28E-07	mr1779	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501367936	NA	6.34E-07	mr1797	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501367936	NA	6.34E-07	mr1801	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501367936	NA	2.63E-08	mr1810	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501367936	NA	5.82E-06	mr1812	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501367936	NA	1.15E-07	mr1824	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501367936	NA	6.28E-07	mr1870	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501367936	NA	9.82E-07	mr1886	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501367936	NA	6.48E-08	mr1979	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251