\
| Variant ID: vg0501314676 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 1314676 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, T: 0.07, others allele: 0.00, population size: 90. )
TGGAAAAGTTTTAAAAAGTCTTCTTTTGGCTTTGGGCCGAAAGTCGGCCCAAATCTCTCTCTCTCTCTCTCCCTCGGCCCAATCCGGCCCGCAGCTGAGC[C/T]
GCTCGCGTGCGCGTGACCGCCCGCTGACAGGTGGGGCCCACCTGTCAATCTTCGTCTACCTCCAGCCGTCGCCCGGCCGAACCCTAGCCGAGCTGCGCCG
CGGCGCAGCTCGGCTAGGGTTCGGCCGGGCGACGGCTGGAGGTAGACGAAGATTGACAGGTGGGCCCCACCTGTCAGCGGGCGGTCACGCGCACGCGAGC[G/A]
GCTCAGCTGCGGGCCGGATTGGGCCGAGGGAGAGAGAGAGAGAGAGATTTGGGCCGACTTTCGGCCCAAAGCCAAAAGAAGACTTTTTAAAACTTTTCCA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 74.80% | 24.30% | 0.89% | 0.00% | NA |
| All Indica | 2759 | 70.70% | 29.00% | 0.25% | 0.00% | NA |
| All Japonica | 1512 | 89.90% | 10.00% | 0.07% | 0.00% | NA |
| Aus | 269 | 23.80% | 66.50% | 9.67% | 0.00% | NA |
| Indica I | 595 | 78.80% | 21.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 80.20% | 19.40% | 0.43% | 0.00% | NA |
| Indica III | 913 | 58.90% | 41.00% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 72.60% | 26.80% | 0.51% | 0.00% | NA |
| Temperate Japonica | 767 | 88.90% | 11.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 98.40% | 1.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 75.50% | 24.10% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 90.60% | 2.10% | 7.29% | 0.00% | NA |
| Intermediate | 90 | 82.20% | 16.70% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0501314676 | C -> T | LOC_Os05g03240.1 | downstream_gene_variant ; 3086.0bp to feature; MODIFIER | silent_mutation | Average:32.767; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| vg0501314676 | C -> T | LOC_Os05g03260.1 | downstream_gene_variant ; 2546.0bp to feature; MODIFIER | silent_mutation | Average:32.767; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| vg0501314676 | C -> T | LOC_Os05g03250.1 | intron_variant ; MODIFIER | silent_mutation | Average:32.767; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0501314676 | NA | 7.83E-07 | mr1201 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501314676 | NA | 1.08E-06 | mr1201 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501314676 | NA | 1.06E-06 | mr1219 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501314676 | NA | 3.65E-06 | mr1219 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501314676 | 2.20E-06 | 3.96E-07 | mr1274 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501314676 | NA | 1.88E-06 | mr1274 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501314676 | NA | 3.15E-07 | mr1201_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501314676 | NA | 1.77E-07 | mr1219_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501314676 | NA | 7.65E-06 | mr1219_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501314676 | NA | 2.69E-06 | mr1274_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |