\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0501314676:

Variant ID: vg0501314676 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 1314676
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, T: 0.07, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


TGGAAAAGTTTTAAAAAGTCTTCTTTTGGCTTTGGGCCGAAAGTCGGCCCAAATCTCTCTCTCTCTCTCTCCCTCGGCCCAATCCGGCCCGCAGCTGAGC[C/T]
GCTCGCGTGCGCGTGACCGCCCGCTGACAGGTGGGGCCCACCTGTCAATCTTCGTCTACCTCCAGCCGTCGCCCGGCCGAACCCTAGCCGAGCTGCGCCG

Reverse complement sequence

CGGCGCAGCTCGGCTAGGGTTCGGCCGGGCGACGGCTGGAGGTAGACGAAGATTGACAGGTGGGCCCCACCTGTCAGCGGGCGGTCACGCGCACGCGAGC[G/A]
GCTCAGCTGCGGGCCGGATTGGGCCGAGGGAGAGAGAGAGAGAGAGATTTGGGCCGACTTTCGGCCCAAAGCCAAAAGAAGACTTTTTAAAACTTTTCCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.80% 24.30% 0.89% 0.00% NA
All Indica  2759 70.70% 29.00% 0.25% 0.00% NA
All Japonica  1512 89.90% 10.00% 0.07% 0.00% NA
Aus  269 23.80% 66.50% 9.67% 0.00% NA
Indica I  595 78.80% 21.20% 0.00% 0.00% NA
Indica II  465 80.20% 19.40% 0.43% 0.00% NA
Indica III  913 58.90% 41.00% 0.11% 0.00% NA
Indica Intermediate  786 72.60% 26.80% 0.51% 0.00% NA
Temperate Japonica  767 88.90% 11.10% 0.00% 0.00% NA
Tropical Japonica  504 98.40% 1.60% 0.00% 0.00% NA
Japonica Intermediate  241 75.50% 24.10% 0.41% 0.00% NA
VI/Aromatic  96 90.60% 2.10% 7.29% 0.00% NA
Intermediate  90 82.20% 16.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0501314676 C -> T LOC_Os05g03240.1 downstream_gene_variant ; 3086.0bp to feature; MODIFIER silent_mutation Average:32.767; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N
vg0501314676 C -> T LOC_Os05g03260.1 downstream_gene_variant ; 2546.0bp to feature; MODIFIER silent_mutation Average:32.767; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N
vg0501314676 C -> T LOC_Os05g03250.1 intron_variant ; MODIFIER silent_mutation Average:32.767; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0501314676 NA 7.83E-07 mr1201 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501314676 NA 1.08E-06 mr1201 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501314676 NA 1.06E-06 mr1219 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501314676 NA 3.65E-06 mr1219 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501314676 2.20E-06 3.96E-07 mr1274 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501314676 NA 1.88E-06 mr1274 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501314676 NA 3.15E-07 mr1201_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501314676 NA 1.77E-07 mr1219_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501314676 NA 7.65E-06 mr1219_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501314676 NA 2.69E-06 mr1274_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251