\
| Variant ID: vg0501245720 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 1245720 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
AAAATCTGAAGTTTTTAAAGTTTGAGTTGAAAATTTTCAAATCTTGATTTGAAATTTTTCGAATCTCGAGTTGAAAGTTTTCAAAATTTTCAAATCTGGA[T/C]
TTGAAAGTTTTCGAATCTCGATTCTCGAGTTGAAAGTTTTCGAATCTGAGTTGAAAGTTTTCAAATCTCAAGTTAAAAGTTTTTAATTCTGAGTTGAAAG
CTTTCAACTCAGAATTAAAAACTTTTAACTTGAGATTTGAAAACTTTCAACTCAGATTCGAAAACTTTCAACTCGAGAATCGAGATTCGAAAACTTTCAA[A/G]
TCCAGATTTGAAAATTTTGAAAACTTTCAACTCGAGATTCGAAAAATTTCAAATCAAGATTTGAAAATTTTCAACTCAAACTTTAAAAACTTCAGATTTT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 62.80% | 33.80% | 3.41% | 0.02% | NA |
| All Indica | 2759 | 49.40% | 45.40% | 5.22% | 0.04% | NA |
| All Japonica | 1512 | 96.50% | 3.20% | 0.26% | 0.00% | NA |
| Aus | 269 | 3.30% | 96.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 62.70% | 26.90% | 10.42% | 0.00% | NA |
| Indica II | 465 | 60.20% | 34.80% | 4.95% | 0.00% | NA |
| Indica III | 913 | 33.40% | 65.00% | 1.64% | 0.00% | NA |
| Indica Intermediate | 786 | 51.40% | 42.90% | 5.60% | 0.13% | NA |
| Temperate Japonica | 767 | 97.30% | 2.30% | 0.39% | 0.00% | NA |
| Tropical Japonica | 504 | 95.40% | 4.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 96.30% | 3.30% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 74.00% | 13.50% | 12.50% | 0.00% | NA |
| Intermediate | 90 | 74.40% | 24.40% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0501245720 | T -> DEL | N | N | silent_mutation | Average:21.739; most accessible tissue: Callus, score: 64.612 | N | N | N | N |
| vg0501245720 | T -> C | LOC_Os05g03120.1 | downstream_gene_variant ; 367.0bp to feature; MODIFIER | silent_mutation | Average:21.739; most accessible tissue: Callus, score: 64.612 | N | N | N | N |
| vg0501245720 | T -> C | LOC_Os05g03130.1 | downstream_gene_variant ; 566.0bp to feature; MODIFIER | silent_mutation | Average:21.739; most accessible tissue: Callus, score: 64.612 | N | N | N | N |
| vg0501245720 | T -> C | LOC_Os05g03120.2 | downstream_gene_variant ; 400.0bp to feature; MODIFIER | silent_mutation | Average:21.739; most accessible tissue: Callus, score: 64.612 | N | N | N | N |
| vg0501245720 | T -> C | LOC_Os05g03120.3 | downstream_gene_variant ; 367.0bp to feature; MODIFIER | silent_mutation | Average:21.739; most accessible tissue: Callus, score: 64.612 | N | N | N | N |
| vg0501245720 | T -> C | LOC_Os05g03120-LOC_Os05g03130 | intergenic_region ; MODIFIER | silent_mutation | Average:21.739; most accessible tissue: Callus, score: 64.612 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0501245720 | NA | 3.54E-06 | mr1004 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501245720 | 8.38E-08 | 1.61E-07 | mr1004 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501245720 | NA | 1.15E-11 | mr1005 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501245720 | 6.41E-09 | 1.62E-08 | mr1005 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501245720 | 2.07E-06 | 4.20E-06 | mr1011 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501245720 | 3.22E-06 | 3.07E-06 | mr1012 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501245720 | 1.36E-06 | 4.12E-07 | mr1261 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501245720 | NA | 4.49E-08 | mr1030_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501245720 | NA | 1.62E-13 | mr1191_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501245720 | NA | 2.47E-34 | mr1448_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501245720 | NA | 1.59E-17 | mr1712_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501245720 | NA | 2.60E-07 | mr1821_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |