\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0501245720:

Variant ID: vg0501245720 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 1245720
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAAATCTGAAGTTTTTAAAGTTTGAGTTGAAAATTTTCAAATCTTGATTTGAAATTTTTCGAATCTCGAGTTGAAAGTTTTCAAAATTTTCAAATCTGGA[T/C]
TTGAAAGTTTTCGAATCTCGATTCTCGAGTTGAAAGTTTTCGAATCTGAGTTGAAAGTTTTCAAATCTCAAGTTAAAAGTTTTTAATTCTGAGTTGAAAG

Reverse complement sequence

CTTTCAACTCAGAATTAAAAACTTTTAACTTGAGATTTGAAAACTTTCAACTCAGATTCGAAAACTTTCAACTCGAGAATCGAGATTCGAAAACTTTCAA[A/G]
TCCAGATTTGAAAATTTTGAAAACTTTCAACTCGAGATTCGAAAAATTTCAAATCAAGATTTGAAAATTTTCAACTCAAACTTTAAAAACTTCAGATTTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.80% 33.80% 3.41% 0.02% NA
All Indica  2759 49.40% 45.40% 5.22% 0.04% NA
All Japonica  1512 96.50% 3.20% 0.26% 0.00% NA
Aus  269 3.30% 96.70% 0.00% 0.00% NA
Indica I  595 62.70% 26.90% 10.42% 0.00% NA
Indica II  465 60.20% 34.80% 4.95% 0.00% NA
Indica III  913 33.40% 65.00% 1.64% 0.00% NA
Indica Intermediate  786 51.40% 42.90% 5.60% 0.13% NA
Temperate Japonica  767 97.30% 2.30% 0.39% 0.00% NA
Tropical Japonica  504 95.40% 4.60% 0.00% 0.00% NA
Japonica Intermediate  241 96.30% 3.30% 0.41% 0.00% NA
VI/Aromatic  96 74.00% 13.50% 12.50% 0.00% NA
Intermediate  90 74.40% 24.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0501245720 T -> DEL N N silent_mutation Average:21.739; most accessible tissue: Callus, score: 64.612 N N N N
vg0501245720 T -> C LOC_Os05g03120.1 downstream_gene_variant ; 367.0bp to feature; MODIFIER silent_mutation Average:21.739; most accessible tissue: Callus, score: 64.612 N N N N
vg0501245720 T -> C LOC_Os05g03130.1 downstream_gene_variant ; 566.0bp to feature; MODIFIER silent_mutation Average:21.739; most accessible tissue: Callus, score: 64.612 N N N N
vg0501245720 T -> C LOC_Os05g03120.2 downstream_gene_variant ; 400.0bp to feature; MODIFIER silent_mutation Average:21.739; most accessible tissue: Callus, score: 64.612 N N N N
vg0501245720 T -> C LOC_Os05g03120.3 downstream_gene_variant ; 367.0bp to feature; MODIFIER silent_mutation Average:21.739; most accessible tissue: Callus, score: 64.612 N N N N
vg0501245720 T -> C LOC_Os05g03120-LOC_Os05g03130 intergenic_region ; MODIFIER silent_mutation Average:21.739; most accessible tissue: Callus, score: 64.612 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0501245720 NA 3.54E-06 mr1004 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501245720 8.38E-08 1.61E-07 mr1004 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501245720 NA 1.15E-11 mr1005 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501245720 6.41E-09 1.62E-08 mr1005 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501245720 2.07E-06 4.20E-06 mr1011 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501245720 3.22E-06 3.07E-06 mr1012 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501245720 1.36E-06 4.12E-07 mr1261 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501245720 NA 4.49E-08 mr1030_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501245720 NA 1.62E-13 mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501245720 NA 2.47E-34 mr1448_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501245720 NA 1.59E-17 mr1712_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501245720 NA 2.60E-07 mr1821_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251