Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0501238192:

Variant ID: vg0501238192 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 1238192
Reference Allele: C	Alternative Allele: G
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, G: 0.01, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:

TTAATTACTCTTTGCATGAGCTACATTTCATCATATTTATGGCCATGCCCAATATCTGTTGTTCTCTCAAAACTTTACATGTTTTGAATGTTTTTATTTG[C/G]
TGTTCATAATCAACAACGTACTAATCCTTCCTATGTGGTTTTATTATTTCTGAAAAAGTAACAGTTATTTTCTTTGTTGCAGGTGTATGCAGTATGCGTC

Reverse complement sequence

GACGCATACTGCATACACCTGCAACAAAGAAAATAACTGTTACTTTTTCAGAAATAATAAAACCACATAGGAAGGATTAGTACGTTGTTGATTATGAACA[G/C]
CAAATAAAAACATTCAAAACATGTAAAGTTTTGAGAGAACAACAGATATTGGGCATGGCCATAAATATGATGAAATGTAGCTCATGCAAAGAGTAATTAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.20%	41.70%	0.04%	0.00%	NA
All Indica	2759	30.80%	69.10%	0.07%	0.00%	NA
All Japonica	1512	97.60%	2.40%	0.00%	0.00%	NA
Aus	269	98.50%	1.50%	0.00%	0.00%	NA
Indica I	595	4.20%	95.60%	0.17%	0.00%	NA
Indica II	465	24.50%	75.50%	0.00%	0.00%	NA
Indica III	913	54.20%	45.80%	0.00%	0.00%	NA
Indica Intermediate	786	27.50%	72.40%	0.13%	0.00%	NA
Temperate Japonica	767	96.60%	3.40%	0.00%	0.00%	NA
Tropical Japonica	504	99.00%	1.00%	0.00%	0.00%	NA
Japonica Intermediate	241	97.50%	2.50%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	74.40%	25.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0501238192	C -> G	LOC_Os05g03120.1	upstream_gene_variant ; 2107.0bp to feature; MODIFIER	silent_mutation	Average:38.091; most accessible tissue: Callus, score: 78.674	N	N	N	N
vg0501238192	C -> G	LOC_Os05g03120.2	upstream_gene_variant ; 2107.0bp to feature; MODIFIER	silent_mutation	Average:38.091; most accessible tissue: Callus, score: 78.674	N	N	N	N
vg0501238192	C -> G	LOC_Os05g03120.3	upstream_gene_variant ; 2107.0bp to feature; MODIFIER	silent_mutation	Average:38.091; most accessible tissue: Callus, score: 78.674	N	N	N	N
vg0501238192	C -> G	LOC_Os05g03110-LOC_Os05g03120	intergenic_region ; MODIFIER	silent_mutation	Average:38.091; most accessible tissue: Callus, score: 78.674	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0501238192	NA	1.77E-08	mr1770	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501238192	NA	8.92E-17	mr1807	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501238192	NA	2.71E-06	mr1247_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501238192	NA	1.74E-06	mr1358_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501238192	NA	2.45E-06	mr1360_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501238192	NA	9.86E-13	mr1717_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501238192	NA	4.57E-07	mr1819_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501238192	NA	3.41E-06	mr1910_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501238192	NA	7.64E-30	mr1932_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501238192	NA	1.28E-11	mr1946_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501238192	NA	1.28E-11	mr1948_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251