\
| Variant ID: vg0501238192 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 1238192 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, G: 0.01, others allele: 0.00, population size: 218. )
TTAATTACTCTTTGCATGAGCTACATTTCATCATATTTATGGCCATGCCCAATATCTGTTGTTCTCTCAAAACTTTACATGTTTTGAATGTTTTTATTTG[C/G]
TGTTCATAATCAACAACGTACTAATCCTTCCTATGTGGTTTTATTATTTCTGAAAAAGTAACAGTTATTTTCTTTGTTGCAGGTGTATGCAGTATGCGTC
GACGCATACTGCATACACCTGCAACAAAGAAAATAACTGTTACTTTTTCAGAAATAATAAAACCACATAGGAAGGATTAGTACGTTGTTGATTATGAACA[G/C]
CAAATAAAAACATTCAAAACATGTAAAGTTTTGAGAGAACAACAGATATTGGGCATGGCCATAAATATGATGAAATGTAGCTCATGCAAAGAGTAATTAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 58.20% | 41.70% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 30.80% | 69.10% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 97.60% | 2.40% | 0.00% | 0.00% | NA |
| Aus | 269 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 4.20% | 95.60% | 0.17% | 0.00% | NA |
| Indica II | 465 | 24.50% | 75.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 54.20% | 45.80% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 27.50% | 72.40% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 96.60% | 3.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.50% | 2.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 74.40% | 25.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0501238192 | C -> G | LOC_Os05g03120.1 | upstream_gene_variant ; 2107.0bp to feature; MODIFIER | silent_mutation | Average:38.091; most accessible tissue: Callus, score: 78.674 | N | N | N | N |
| vg0501238192 | C -> G | LOC_Os05g03120.2 | upstream_gene_variant ; 2107.0bp to feature; MODIFIER | silent_mutation | Average:38.091; most accessible tissue: Callus, score: 78.674 | N | N | N | N |
| vg0501238192 | C -> G | LOC_Os05g03120.3 | upstream_gene_variant ; 2107.0bp to feature; MODIFIER | silent_mutation | Average:38.091; most accessible tissue: Callus, score: 78.674 | N | N | N | N |
| vg0501238192 | C -> G | LOC_Os05g03110-LOC_Os05g03120 | intergenic_region ; MODIFIER | silent_mutation | Average:38.091; most accessible tissue: Callus, score: 78.674 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0501238192 | NA | 1.77E-08 | mr1770 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501238192 | NA | 8.92E-17 | mr1807 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501238192 | NA | 2.71E-06 | mr1247_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501238192 | NA | 1.74E-06 | mr1358_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501238192 | NA | 2.45E-06 | mr1360_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501238192 | NA | 9.86E-13 | mr1717_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501238192 | NA | 4.57E-07 | mr1819_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501238192 | NA | 3.41E-06 | mr1910_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501238192 | NA | 7.64E-30 | mr1932_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501238192 | NA | 1.28E-11 | mr1946_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501238192 | NA | 1.28E-11 | mr1948_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |