\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0501238192:

Variant ID: vg0501238192 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 1238192
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, G: 0.01, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:


TTAATTACTCTTTGCATGAGCTACATTTCATCATATTTATGGCCATGCCCAATATCTGTTGTTCTCTCAAAACTTTACATGTTTTGAATGTTTTTATTTG[C/G]
TGTTCATAATCAACAACGTACTAATCCTTCCTATGTGGTTTTATTATTTCTGAAAAAGTAACAGTTATTTTCTTTGTTGCAGGTGTATGCAGTATGCGTC

Reverse complement sequence

GACGCATACTGCATACACCTGCAACAAAGAAAATAACTGTTACTTTTTCAGAAATAATAAAACCACATAGGAAGGATTAGTACGTTGTTGATTATGAACA[G/C]
CAAATAAAAACATTCAAAACATGTAAAGTTTTGAGAGAACAACAGATATTGGGCATGGCCATAAATATGATGAAATGTAGCTCATGCAAAGAGTAATTAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.20% 41.70% 0.04% 0.00% NA
All Indica  2759 30.80% 69.10% 0.07% 0.00% NA
All Japonica  1512 97.60% 2.40% 0.00% 0.00% NA
Aus  269 98.50% 1.50% 0.00% 0.00% NA
Indica I  595 4.20% 95.60% 0.17% 0.00% NA
Indica II  465 24.50% 75.50% 0.00% 0.00% NA
Indica III  913 54.20% 45.80% 0.00% 0.00% NA
Indica Intermediate  786 27.50% 72.40% 0.13% 0.00% NA
Temperate Japonica  767 96.60% 3.40% 0.00% 0.00% NA
Tropical Japonica  504 99.00% 1.00% 0.00% 0.00% NA
Japonica Intermediate  241 97.50% 2.50% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 74.40% 25.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0501238192 C -> G LOC_Os05g03120.1 upstream_gene_variant ; 2107.0bp to feature; MODIFIER silent_mutation Average:38.091; most accessible tissue: Callus, score: 78.674 N N N N
vg0501238192 C -> G LOC_Os05g03120.2 upstream_gene_variant ; 2107.0bp to feature; MODIFIER silent_mutation Average:38.091; most accessible tissue: Callus, score: 78.674 N N N N
vg0501238192 C -> G LOC_Os05g03120.3 upstream_gene_variant ; 2107.0bp to feature; MODIFIER silent_mutation Average:38.091; most accessible tissue: Callus, score: 78.674 N N N N
vg0501238192 C -> G LOC_Os05g03110-LOC_Os05g03120 intergenic_region ; MODIFIER silent_mutation Average:38.091; most accessible tissue: Callus, score: 78.674 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0501238192 NA 1.77E-08 mr1770 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501238192 NA 8.92E-17 mr1807 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501238192 NA 2.71E-06 mr1247_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501238192 NA 1.74E-06 mr1358_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501238192 NA 2.45E-06 mr1360_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501238192 NA 9.86E-13 mr1717_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501238192 NA 4.57E-07 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501238192 NA 3.41E-06 mr1910_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501238192 NA 7.64E-30 mr1932_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501238192 NA 1.28E-11 mr1946_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501238192 NA 1.28E-11 mr1948_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251