Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0501179129:

Variant ID: vg0501179129 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 1179129
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTAAAAGTTTAATTAAAATTGGTACGATGTGATAGTAAAGTTGTGTGTGTATGAAAGGTTTAATGTGATGGAAAATTGGAAGTTTGGAAAAAAAACTTTG[G/A]
AACTAAACAGGGGCAGTTCACACCAAAATTGGAAGTTTTGTTAAAATTAAAACGATGTGACGGAAAAGTTAGAAGTTTATGTGTAAAAAAAAAAGTTTTG

Reverse complement sequence

CAAAACTTTTTTTTTTACACATAAACTTCTAACTTTTCCGTCACATCGTTTTAATTTTAACAAAACTTCCAATTTTGGTGTGAACTGCCCCTGTTTAGTT[C/T]
CAAAGTTTTTTTTCCAAACTTCCAATTTTCCATCACATTAAACCTTTCATACACACACAACTTTACTATCACATCGTACCAATTTTAATTAAACTTTTAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.00% 15.80% 0.13% 0.00% NA
All Indica  2759 77.20% 22.70% 0.14% 0.00% NA
All Japonica  1512 92.30% 7.70% 0.00% 0.00% NA
Aus  269 98.90% 0.40% 0.74% 0.00% NA
Indica I  595 77.30% 22.70% 0.00% 0.00% NA
Indica II  465 86.50% 13.10% 0.43% 0.00% NA
Indica III  913 72.00% 27.90% 0.11% 0.00% NA
Indica Intermediate  786 77.70% 22.10% 0.13% 0.00% NA
Temperate Japonica  767 90.70% 9.30% 0.00% 0.00% NA
Tropical Japonica  504 98.80% 1.20% 0.00% 0.00% NA
Japonica Intermediate  241 83.40% 16.60% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 94.40% 5.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0501179129 G -> A LOC_Os05g03040-LOC_Os05g03050 intergenic_region ; MODIFIER silent_mutation Average:77.334; most accessible tissue: Minghui63 young leaf, score: 98.38 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0501179129 G A 0.0 0.0 -0.01 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0501179129 8.24E-06 NA mr1588 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501179129 NA 5.78E-06 mr1448_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501179129 NA 1.46E-07 mr1510_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501179129 NA 3.63E-06 mr1538_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501179129 NA 2.14E-06 mr1624_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501179129 NA 9.60E-06 mr1702_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251