\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0501163390:

Variant ID: vg0501163390 (JBrowse)Variation Type: INDEL
Chromosome: chr05Position: 1163390
Reference Allele: GGAGAAGCTAAlternative Allele: AGAGAAGCTA,G
Primary Allele: GGAGAAGCTASecondary Allele: AGAGAAGCTA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCTGCCCCAAACAGTCCACAGCTTCTGAGAATCTGTAGTTATAGATTCTGAAAAATTAACTAAAAAGCCAGAAGCTGAATGAACTAAGAAGCCAGAAGCT[GGAGAAGCTA/AGAGAAGCTA,G]
GGTTTCGGAGCTTATCCAGATTCTCAGAAGTTGGCTACCAAACAGCTGCTTCTCATAATCTAAAACTCCCCAAACAGGCCCTATATTAGCTACTCCCTCC

Reverse complement sequence

GGAGGGAGTAGCTAATATAGGGCCTGTTTGGGGAGTTTTAGATTATGAGAAGCAGCTGTTTGGTAGCCAACTTCTGAGAATCTGGATAAGCTCCGAAACC[TAGCTTCTCC/TAGCTTCTCT,C]
AGCTTCTGGCTTCTTAGTTCATTCAGCTTCTGGCTTTTTAGTTAATTTTTCAGAATCTATAACTACAGATTCTCAGAAGCTGTGGACTGTTTGGGGCAGC

Allele Frequencies:

Populations Population SizeFrequency of GGAGAAGCTA(primary allele) Frequency of AGAGAAGCTA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.50% 46.30% 0.15% 0.00% G: 0.06%
All Indica  2759 22.90% 76.70% 0.25% 0.00% G: 0.11%
All Japonica  1512 97.80% 2.20% 0.00% 0.00% NA
Aus  269 97.40% 2.60% 0.00% 0.00% NA
Indica I  595 1.00% 98.80% 0.17% 0.00% NA
Indica II  465 21.30% 78.30% 0.43% 0.00% NA
Indica III  913 39.10% 60.60% 0.33% 0.00% NA
Indica Intermediate  786 21.80% 77.70% 0.13% 0.00% G: 0.38%
Temperate Japonica  767 97.00% 3.00% 0.00% 0.00% NA
Tropical Japonica  504 99.00% 1.00% 0.00% 0.00% NA
Japonica Intermediate  241 97.50% 2.50% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 70.00% 30.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0501163390 GGAGAAGCTA -> AGAGAAGCTA LOC_Os05g03040.1 upstream_gene_variant ; 3123.0bp to feature; MODIFIER silent_mutation Average:72.776; most accessible tissue: Zhenshan97 root, score: 99.418 N N N N
vg0501163390 GGAGAAGCTA -> AGAGAAGCTA LOC_Os05g03040.2 upstream_gene_variant ; 3687.0bp to feature; MODIFIER silent_mutation Average:72.776; most accessible tissue: Zhenshan97 root, score: 99.418 N N N N
vg0501163390 GGAGAAGCTA -> AGAGAAGCTA LOC_Os05g03040.3 upstream_gene_variant ; 3185.0bp to feature; MODIFIER silent_mutation Average:72.776; most accessible tissue: Zhenshan97 root, score: 99.418 N N N N
vg0501163390 GGAGAAGCTA -> AGAGAAGCTA LOC_Os05g03040-LOC_Os05g03050 intergenic_region ; MODIFIER silent_mutation Average:72.776; most accessible tissue: Zhenshan97 root, score: 99.418 N N N N
vg0501163390 GGAGAAGCTA -> G LOC_Os05g03040.1 upstream_gene_variant ; 3124.0bp to feature; MODIFIER silent_mutation Average:72.776; most accessible tissue: Zhenshan97 root, score: 99.418 N N N N
vg0501163390 GGAGAAGCTA -> G LOC_Os05g03040.2 upstream_gene_variant ; 3688.0bp to feature; MODIFIER silent_mutation Average:72.776; most accessible tissue: Zhenshan97 root, score: 99.418 N N N N
vg0501163390 GGAGAAGCTA -> G LOC_Os05g03040.3 upstream_gene_variant ; 3186.0bp to feature; MODIFIER silent_mutation Average:72.776; most accessible tissue: Zhenshan97 root, score: 99.418 N N N N
vg0501163390 GGAGAAGCTA -> G LOC_Os05g03040-LOC_Os05g03050 intergenic_region ; MODIFIER silent_mutation Average:72.776; most accessible tissue: Zhenshan97 root, score: 99.418 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0501163390 GGAGA* AGAGA* -0.04 -0.04 -0.04 -0.02 -0.03 -0.03
vg0501163390 GGAGA* G 0.13 -0.05 -0.09 0.07 0.03 0.1

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0501163390 NA 2.28E-13 mr1531 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501163390 NA 2.44E-16 mr1807 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501163390 NA 5.30E-12 mr1666_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501163390 NA 1.39E-14 mr1717_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501163390 NA 5.87E-07 mr1754_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501163390 NA 8.88E-06 mr1768_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501163390 NA 7.02E-13 mr1770_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501163390 NA 1.02E-07 mr1910_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501163390 NA 5.82E-10 mr1946_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501163390 NA 5.82E-10 mr1948_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251