\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0501159328:

Variant ID: vg0501159328 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 1159328
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 101. )

Flanking Sequence (100 bp) in Reference Genome:


TTGGCCGCCTGAGGCTGCGGCTGCGGCGGCGGCGGCGGTGGCGCCGGGGGAGGCGCGTGGGCGAGGATTCTGATGTCTGGGTGTGGGCGCGGTGGGTCGG[G/A]
GCGGAGGAAGCCGAGCTCCGCCCAATGCTGCGGCGAGGGAGCGGCGGAAGGGAATAGCTCCCGGGTGACGAGCAGCTGCTGGTGTTGGTGGTGCGGCGGC

Reverse complement sequence

GCCGCCGCACCACCAACACCAGCAGCTGCTCGTCACCCGGGAGCTATTCCCTTCCGCCGCTCCCTCGCCGCAGCATTGGGCGGAGCTCGGCTTCCTCCGC[C/T]
CCGACCCACCGCGCCCACACCCAGACATCAGAATCCTCGCCCACGCGCCTCCCCCGGCGCCACCGCCGCCGCCGCCGCAGCCGCAGCCTCAGGCGGCCAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.40% 16.40% 0.15% 0.00% NA
All Indica  2759 72.80% 27.00% 0.25% 0.00% NA
All Japonica  1512 98.30% 1.70% 0.00% 0.00% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 74.60% 25.40% 0.00% 0.00% NA
Indica II  465 85.40% 14.20% 0.43% 0.00% NA
Indica III  913 63.10% 36.70% 0.22% 0.00% NA
Indica Intermediate  786 75.20% 24.40% 0.38% 0.00% NA
Temperate Japonica  767 97.40% 2.60% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.60% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 96.70% 3.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0501159328 G -> A LOC_Os05g03040.1 missense_variant ; p.Pro126Ser; MODERATE nonsynonymous_codon ; P126S Average:74.014; most accessible tissue: Minghui63 young leaf, score: 98.123 possibly damaging 1.531 TOLERATED 0.71
vg0501159328 G -> A LOC_Os05g03040.2 missense_variant ; p.Pro126Ser; MODERATE nonsynonymous_codon ; P126S Average:74.014; most accessible tissue: Minghui63 young leaf, score: 98.123 possibly damaging 1.531 TOLERATED 0.51
vg0501159328 G -> A LOC_Os05g03040.3 missense_variant ; p.Pro126Ser; MODERATE nonsynonymous_codon ; P126S Average:74.014; most accessible tissue: Minghui63 young leaf, score: 98.123 possibly damaging 1.531 TOLERATED 0.51

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0501159328 G A -0.02 -0.01 -0.01 -0.01 -0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0501159328 NA 4.33E-06 mr1179 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501159328 NA 1.05E-06 mr1274 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501159328 NA 5.23E-08 mr1510 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501159328 NA 9.34E-09 mr1510 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501159328 NA 6.14E-06 mr1538 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501159328 NA 1.86E-07 mr1588 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501159328 NA 3.73E-08 mr1624 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501159328 NA 5.75E-07 mr1624 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501159328 NA 1.71E-06 mr1630 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501159328 NA 5.37E-06 mr1693 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501159328 NA 3.26E-07 mr1702 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501159328 NA 1.12E-07 mr1729 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501159328 NA 2.19E-06 mr1751 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501159328 NA 9.55E-07 mr1785 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501159328 NA 3.68E-07 mr1925 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501159328 NA 7.70E-08 mr1510_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501159328 NA 9.03E-06 mr1538_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501159328 NA 1.57E-06 mr1624_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251