\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0501156158:

Variant ID: vg0501156158 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 1156158
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCTGTTCTCTGAGATCAGGGGGCAAAGAGACTAGGAGCATTTGGAACATTTTTTGGGCGTTTTATGTGTGGATGCAAATACAGTCATGAATCCCAATTAA[C/T]
TAATCACTACAAGAAACCACCCGGCCGGCCCGCCGGCGCAAAGACGAAAACGTTGAAACGCCGGCGACGGCCAAGAAAAAAAAAAATTTGCCGGCTTCCC

Reverse complement sequence

GGGAAGCCGGCAAATTTTTTTTTTTCTTGGCCGTCGCCGGCGTTTCAACGTTTTCGTCTTTGCGCCGGCGGGCCGGCCGGGTGGTTTCTTGTAGTGATTA[G/A]
TTAATTGGGATTCATGACTGTATTTGCATCCACACATAAAACGCCCAAAAAATGTTCCAAATGCTCCTAGTCTCTTTGCCCCCTGATCTCAGAGAACAGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.40% 28.40% 0.15% 0.00% NA
All Indica  2759 98.80% 1.20% 0.00% 0.00% NA
All Japonica  1512 21.20% 78.40% 0.33% 0.00% NA
Aus  269 98.50% 0.70% 0.74% 0.00% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 96.80% 3.20% 0.00% 0.00% NA
Indica III  913 99.70% 0.30% 0.00% 0.00% NA
Indica Intermediate  786 98.50% 1.50% 0.00% 0.00% NA
Temperate Japonica  767 9.90% 89.60% 0.52% 0.00% NA
Tropical Japonica  504 34.50% 65.50% 0.00% 0.00% NA
Japonica Intermediate  241 29.50% 70.10% 0.41% 0.00% NA
VI/Aromatic  96 12.50% 87.50% 0.00% 0.00% NA
Intermediate  90 56.70% 43.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0501156158 C -> T LOC_Os05g03040.1 3_prime_UTR_variant ; 142.0bp to feature; MODIFIER silent_mutation Average:77.959; most accessible tissue: Minghui63 young leaf, score: 99.489 N N N N
vg0501156158 C -> T LOC_Os05g03040.2 3_prime_UTR_variant ; 2040.0bp to feature; MODIFIER silent_mutation Average:77.959; most accessible tissue: Minghui63 young leaf, score: 99.489 N N N N
vg0501156158 C -> T LOC_Os05g03040.3 3_prime_UTR_variant ; 2040.0bp to feature; MODIFIER silent_mutation Average:77.959; most accessible tissue: Minghui63 young leaf, score: 99.489 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0501156158 C T -0.02 0.01 0.0 -0.04 -0.03 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0501156158 NA 1.24E-12 mr1149 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501156158 4.69E-06 NA mr1180 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501156158 6.63E-06 3.36E-09 mr1180 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501156158 NA 3.28E-08 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501156158 NA 2.08E-07 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501156158 NA 1.58E-20 mr1588 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501156158 NA 7.76E-15 mr1162_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501156158 NA 5.24E-07 mr1183_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501156158 NA 4.12E-28 mr1588_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501156158 NA 6.17E-12 mr1722_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251