\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0501133128:

Variant ID: vg0501133128 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 1133128
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:


CAGTGTCTTCTACTTGCATCGACCGATCTCTATCTAGGGTTTTGTCAATATTAGCTAGATTTCTTTGCTGGCTTAGATTATATAATGTATCTACCACCCT[G/A]
AAAATCAATCAAATGCTTGATTGTCTAGATATTATGTTTCTTTTTATACTTAGTATTACATCAGTTAAGTTTGATCTACTAAGTCGTGCTTGGAACCATA

Reverse complement sequence

TATGGTTCCAAGCACGACTTAGTAGATCAAACTTAACTGATGTAATACTAAGTATAAAAAGAAACATAATATCTAGACAATCAAGCATTTGATTGATTTT[C/T]
AGGGTGGTAGATACATTATATAATCTAAGCCAGCAAAGAAATCTAGCTAATATTGACAAAACCCTAGATAGAGATCGGTCGATGCAAGTAGAAGACACTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.30% 10.80% 10.05% 4.80% NA
All Indica  2759 57.20% 18.10% 16.75% 7.90% NA
All Japonica  1512 99.30% 0.20% 0.26% 0.20% NA
Aus  269 98.10% 0.70% 1.12% 0.00% NA
Indica I  595 31.60% 28.70% 30.08% 9.58% NA
Indica II  465 56.80% 19.10% 15.05% 9.03% NA
Indica III  913 77.90% 8.40% 8.32% 5.37% NA
Indica Intermediate  786 52.90% 20.70% 17.43% 8.91% NA
Temperate Japonica  767 99.60% 0.30% 0.13% 0.00% NA
Tropical Japonica  504 99.60% 0.20% 0.20% 0.00% NA
Japonica Intermediate  241 97.90% 0.00% 0.83% 1.24% NA
VI/Aromatic  96 97.90% 1.00% 1.04% 0.00% NA
Intermediate  90 82.20% 5.60% 5.56% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0501133128 G -> DEL N N silent_mutation Average:40.514; most accessible tissue: Zhenshan97 panicle, score: 59.59 N N N N
vg0501133128 G -> A LOC_Os05g03000.1 upstream_gene_variant ; 700.0bp to feature; MODIFIER silent_mutation Average:40.514; most accessible tissue: Zhenshan97 panicle, score: 59.59 N N N N
vg0501133128 G -> A LOC_Os05g03000.2 upstream_gene_variant ; 720.0bp to feature; MODIFIER silent_mutation Average:40.514; most accessible tissue: Zhenshan97 panicle, score: 59.59 N N N N
vg0501133128 G -> A LOC_Os05g03010.1 downstream_gene_variant ; 4838.0bp to feature; MODIFIER silent_mutation Average:40.514; most accessible tissue: Zhenshan97 panicle, score: 59.59 N N N N
vg0501133128 G -> A LOC_Os05g03000-LOC_Os05g03010 intergenic_region ; MODIFIER silent_mutation Average:40.514; most accessible tissue: Zhenshan97 panicle, score: 59.59 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0501133128 NA 9.81E-06 mr1471 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501133128 NA 2.42E-06 mr1630 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501133128 NA 7.58E-06 mr1691 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501133128 NA 3.91E-06 mr1729 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501133128 NA 4.71E-06 mr1741 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501133128 NA 2.54E-06 mr1782 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501133128 NA 6.30E-14 mr1807 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501133128 8.52E-06 4.54E-07 mr1815 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251