Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0501133128:

Variant ID: vg0501133128 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 1133128
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:

CAGTGTCTTCTACTTGCATCGACCGATCTCTATCTAGGGTTTTGTCAATATTAGCTAGATTTCTTTGCTGGCTTAGATTATATAATGTATCTACCACCCT[G/A]
AAAATCAATCAAATGCTTGATTGTCTAGATATTATGTTTCTTTTTATACTTAGTATTACATCAGTTAAGTTTGATCTACTAAGTCGTGCTTGGAACCATA

Reverse complement sequence

TATGGTTCCAAGCACGACTTAGTAGATCAAACTTAACTGATGTAATACTAAGTATAAAAAGAAACATAATATCTAGACAATCAAGCATTTGATTGATTTT[C/T]
AGGGTGGTAGATACATTATATAATCTAAGCCAGCAAAGAAATCTAGCTAATATTGACAAAACCCTAGATAGAGATCGGTCGATGCAAGTAGAAGACACTG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	74.30%	10.80%	10.05%	4.80%	NA
All Indica	2759	57.20%	18.10%	16.75%	7.90%	NA
All Japonica	1512	99.30%	0.20%	0.26%	0.20%	NA
Aus	269	98.10%	0.70%	1.12%	0.00%	NA
Indica I	595	31.60%	28.70%	30.08%	9.58%	NA
Indica II	465	56.80%	19.10%	15.05%	9.03%	NA
Indica III	913	77.90%	8.40%	8.32%	5.37%	NA
Indica Intermediate	786	52.90%	20.70%	17.43%	8.91%	NA
Temperate Japonica	767	99.60%	0.30%	0.13%	0.00%	NA
Tropical Japonica	504	99.60%	0.20%	0.20%	0.00%	NA
Japonica Intermediate	241	97.90%	0.00%	0.83%	1.24%	NA
VI/Aromatic	96	97.90%	1.00%	1.04%	0.00%	NA
Intermediate	90	82.20%	5.60%	5.56%	6.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0501133128	G -> DEL	N	N	silent_mutation	Average:40.514; most accessible tissue: Zhenshan97 panicle, score: 59.59	N	N	N	N
vg0501133128	G -> A	LOC_Os05g03000.1	upstream_gene_variant ; 700.0bp to feature; MODIFIER	silent_mutation	Average:40.514; most accessible tissue: Zhenshan97 panicle, score: 59.59	N	N	N	N
vg0501133128	G -> A	LOC_Os05g03000.2	upstream_gene_variant ; 720.0bp to feature; MODIFIER	silent_mutation	Average:40.514; most accessible tissue: Zhenshan97 panicle, score: 59.59	N	N	N	N
vg0501133128	G -> A	LOC_Os05g03010.1	downstream_gene_variant ; 4838.0bp to feature; MODIFIER	silent_mutation	Average:40.514; most accessible tissue: Zhenshan97 panicle, score: 59.59	N	N	N	N
vg0501133128	G -> A	LOC_Os05g03000-LOC_Os05g03010	intergenic_region ; MODIFIER	silent_mutation	Average:40.514; most accessible tissue: Zhenshan97 panicle, score: 59.59	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0501133128	NA	9.81E-06	mr1471	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501133128	NA	2.42E-06	mr1630	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501133128	NA	7.58E-06	mr1691	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501133128	NA	3.91E-06	mr1729	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501133128	NA	4.71E-06	mr1741	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501133128	NA	2.54E-06	mr1782	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501133128	NA	6.30E-14	mr1807	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501133128	8.52E-06	4.54E-07	mr1815	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251