\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0501127004:

Variant ID: vg0501127004 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 1127004
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.01, others allele: 0.00, population size: 286. )

Flanking Sequence (100 bp) in Reference Genome:


GTGATTCCAGCATCCTGAAATCTGAACCTTCGGGAACCCCATATCGAAGCAGCTGGATGATTGTACCATTCTTTTTAAAATGTTGAACACTTGCAGAGAA[C/T]
TCATATGTTGCAAGGGATTTCAGATAATGCTCTCAGACCCACGAATCACAACAGTTTAATATAACCACATAATAAGGATCAGTAGCTAAACGAACCAAAA

Reverse complement sequence

TTTTGGTTCGTTTAGCTACTGATCCTTATTATGTGGTTATATTAAACTGTTGTGATTCGTGGGTCTGAGAGCATTATCTGAAATCCCTTGCAACATATGA[G/A]
TTCTCTGCAAGTGTTCAACATTTTAAAAAGAATGGTACAATCATCCAGCTGCTTCGATATGGGGTTCCCGAAGGTTCAGATTTCAGGATGCTGGAATCAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.30% 25.50% 0.15% 0.11% NA
All Indica  2759 57.60% 42.10% 0.14% 0.18% NA
All Japonica  1512 98.30% 1.70% 0.07% 0.00% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 70.10% 29.70% 0.17% 0.00% NA
Indica II  465 54.60% 44.70% 0.22% 0.43% NA
Indica III  913 49.00% 50.70% 0.22% 0.11% NA
Indica Intermediate  786 59.90% 39.80% 0.00% 0.25% NA
Temperate Japonica  767 97.70% 2.30% 0.00% 0.00% NA
Tropical Japonica  504 98.80% 1.00% 0.20% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 82.20% 15.60% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0501127004 C -> T LOC_Os05g03000.1 downstream_gene_variant ; 7.0bp to feature; MODIFIER silent_mutation Average:51.364; most accessible tissue: Callus, score: 80.538 N N N N
vg0501127004 C -> T LOC_Os05g03000.2 downstream_gene_variant ; 7.0bp to feature; MODIFIER silent_mutation Average:51.364; most accessible tissue: Callus, score: 80.538 N N N N
vg0501127004 C -> T LOC_Os05g02990-LOC_Os05g03000 intergenic_region ; MODIFIER silent_mutation Average:51.364; most accessible tissue: Callus, score: 80.538 N N N N
vg0501127004 C -> DEL N N silent_mutation Average:51.364; most accessible tissue: Callus, score: 80.538 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0501127004 NA 8.50E-07 mr1588 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501127004 NA 4.07E-06 mr1630 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501127004 NA 4.19E-06 mr1693 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501127004 NA 3.45E-06 mr1729 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501127004 NA 8.73E-06 mr1783 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501127004 NA 2.84E-07 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501127004 NA 8.45E-08 mr1815 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501127004 NA 4.92E-07 mr1925 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501127004 NA 6.52E-07 mr1498_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501127004 NA 1.44E-06 mr1679_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251