Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0501038727:

Variant ID: vg0501038727 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 1038727
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.94, T: 0.05, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:

GCCAGGATCGGGCGGAGTCCGCTAGGGCCACTGGTAGATAGTTTGCCATGGCCTTGCTGTCTCCTCCTGCTGCGCGGATTGCGAGTCCGTAGACGGTGAG[C/T]
CAAGACTCTGGATTAGTGGTGTCGTCATACTTCTCGTTTCCAGTCGGCTTAAAGCCGGCTGGCCAATCCACTCGACGCAGGTCATTAGTGAAGGCAGCTA

Reverse complement sequence

TAGCTGCCTTCACTAATGACCTGCGTCGAGTGGATTGGCCAGCCGGCTTTAAGCCGACTGGAAACGAGAAGTATGACGACACCACTAATCCAGAGTCTTG[G/A]
CTCACCGTCTACGGACTCGCAATCCGCGCAGCAGGAGGAGACAGCAAGGCCATGGCAAACTATCTACCAGTGGCCCTAGCGGACTCCGCCCGATCCTGGC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.10%	49.60%	0.17%	0.15%	NA
All Indica	2759	25.80%	73.70%	0.25%	0.25%	NA
All Japonica	1512	97.50%	2.50%	0.00%	0.00%	NA
Aus	269	18.20%	81.80%	0.00%	0.00%	NA
Indica I	595	3.40%	95.80%	0.34%	0.50%	NA
Indica II	465	24.50%	75.30%	0.22%	0.00%	NA
Indica III	913	41.70%	58.10%	0.11%	0.11%	NA
Indica Intermediate	786	24.90%	74.30%	0.38%	0.38%	NA
Temperate Japonica	767	96.70%	3.30%	0.00%	0.00%	NA
Tropical Japonica	504	99.00%	1.00%	0.00%	0.00%	NA
Japonica Intermediate	241	96.70%	3.30%	0.00%	0.00%	NA
VI/Aromatic	96	76.00%	24.00%	0.00%	0.00%	NA
Intermediate	90	67.80%	31.10%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0501038727	C -> T	LOC_Os05g02860.1	stop_gained ; p.Trp458*; HIGH	stop_gained	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0501038727	C -> DEL	LOC_Os05g02860.1	N	frameshift_variant	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0501038727	NA	1.09E-09	mr1322	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501038727	NA	7.89E-07	mr1527	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501038727	NA	4.05E-19	mr1195_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501038727	2.76E-06	NA	mr1295_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501038727	NA	1.25E-06	mr1358_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501038727	NA	1.27E-08	mr1482_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501038727	NA	1.34E-10	mr1537_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501038727	NA	1.18E-06	mr1568_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501038727	NA	3.17E-20	mr1592_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501038727	5.48E-06	NA	mr1743_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501038727	NA	2.15E-09	mr1748_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501038727	NA	3.31E-06	mr1768_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501038727	NA	7.18E-13	mr1770_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501038727	NA	3.89E-08	mr1783_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501038727	NA	1.42E-15	mr1790_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501038727	NA	7.37E-08	mr1819_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501038727	NA	9.75E-08	mr1837_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501038727	NA	5.99E-16	mr1842_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501038727	NA	1.63E-06	mr1872_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501038727	NA	2.82E-14	mr1902_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501038727	NA	3.54E-06	mr1915_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501038727	NA	3.06E-09	mr1946_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501038727	NA	5.44E-10	mr1947_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501038727	NA	3.06E-09	mr1948_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251