\
| Variant ID: vg0501035247 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 1035247 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.79, T: 0.21, others allele: 0.00, population size: 218. )
GCTCGGCTTCGTTTTTGTCTTGAGGGAGTTCTTGCCTGCTCAAAAATTTTATAAACGGTTCTCTCTAGTCGGCTTCGATCATGCTTATGCCTTGAGTATC[C/T]
ATGGCTTCGACTGTCTCTTTTCTGGGCACGGTTGGTTCGTAAAGGTGTTCGACAAACACATTTGAAGGAGCTGCTTCCCGTTTTGAACCAAAATTGGCCA
TGGCCAATTTTGGTTCAAAACGGGAAGCAGCTCCTTCAAATGTGTTTGTCGAACACCTTTACGAACCAACCGTGCCCAGAAAAGAGACAGTCGAAGCCAT[G/A]
GATACTCAAGGCATAAGCATGATCGAAGCCGACTAGAGAGAACCGTTTATAAAATTTTTGAGCAGGCAAGAACTCCCTCAAGACAAAAACGAAGCCGAGC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 54.40% | 39.60% | 3.62% | 2.37% | NA |
| All Indica | 2759 | 82.00% | 7.90% | 6.05% | 4.02% | NA |
| All Japonica | 1512 | 2.50% | 97.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 81.80% | 18.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.00% | 0.50% | 0.50% | 0.00% | NA |
| Indica II | 465 | 76.60% | 14.00% | 6.24% | 3.23% | NA |
| Indica III | 913 | 75.10% | 8.00% | 9.42% | 7.45% | NA |
| Indica Intermediate | 786 | 80.40% | 9.80% | 6.23% | 3.56% | NA |
| Temperate Japonica | 767 | 3.30% | 96.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 1.20% | 98.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 2.90% | 97.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 25.00% | 75.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 28.90% | 65.60% | 4.44% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0501035247 | C -> T | LOC_Os05g02850.1 | downstream_gene_variant ; 1661.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0501035247 | C -> T | LOC_Os05g02860.1 | intron_variant ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0501035247 | C -> DEL | N | N | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0501035247 | NA | 3.04E-37 | mr1075_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501035247 | NA | 1.17E-06 | mr1358_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501035247 | NA | 5.04E-06 | mr1360_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501035247 | NA | 3.53E-07 | mr1482_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501035247 | NA | 1.10E-20 | mr1592_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501035247 | NA | 1.81E-10 | mr1595_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501035247 | NA | 1.09E-09 | mr1600_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501035247 | NA | 9.40E-08 | mr1748_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501035247 | NA | 1.33E-12 | mr1770_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501035247 | NA | 8.57E-08 | mr1783_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501035247 | NA | 2.59E-07 | mr1804_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501035247 | NA | 6.72E-08 | mr1819_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501035247 | NA | 3.97E-08 | mr1837_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501035247 | NA | 9.45E-11 | mr1893_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501035247 | NA | 2.84E-07 | mr1915_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501035247 | NA | 7.44E-11 | mr1946_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501035247 | NA | 1.43E-10 | mr1947_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501035247 | NA | 7.44E-11 | mr1948_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |