Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0500918476:

Variant ID: vg0500918476 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 918476
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TATCGGAGGAGAGGAGAAGGGGAGGAGAAGAACAGATAGAACCGGGAGGGAGGAGGGGAGGAGGAGATATGTATCTCGATCCCGCACGCCTCGATCTCTC[C/T]
GCGCATGCTGATCTTTTTTCTCGGTTGGTAACACCAACCAGGACTAAAGATTGATATTTAATCCCGATTGGTAACATCAACCGGGACTAAAGATATTAGA

Reverse complement sequence

TCTAATATCTTTAGTCCCGGTTGATGTTACCAATCGGGATTAAATATCAATCTTTAGTCCTGGTTGGTGTTACCAACCGAGAAAAAAGATCAGCATGCGC[G/A]
GAGAGATCGAGGCGTGCGGGATCGAGATACATATCTCCTCCTCCCCTCCTCCCTCCCGGTTCTATCTGTTCTTCTCCTCCCCTTCTCCTCTCCTCCGATA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	92.90%	7.00%	0.06%	0.00%	NA
All Indica	2759	96.00%	3.90%	0.11%	0.00%	NA
All Japonica	1512	91.60%	8.40%	0.00%	0.00%	NA
Aus	269	67.30%	32.70%	0.00%	0.00%	NA
Indica I	595	98.20%	1.80%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	92.20%	7.70%	0.11%	0.00%	NA
Indica Intermediate	786	96.40%	3.30%	0.25%	0.00%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	78.40%	21.60%	0.00%	0.00%	NA
Japonica Intermediate	241	92.90%	7.10%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	91.10%	8.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0500918476	C -> T	LOC_Os05g02630.1	upstream_gene_variant ; 1116.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0500918476	C -> T	LOC_Os05g02640.1	upstream_gene_variant ; 3561.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0500918476	C -> T	LOC_Os05g02620.1	downstream_gene_variant ; 4730.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0500918476	C -> T	LOC_Os05g02620-LOC_Os05g02630	intergenic_region ; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0500918476	9.84E-06	9.83E-06	mr1261	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500918476	NA	7.91E-06	mr1245_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500918476	7.75E-06	7.75E-06	mr1312_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500918476	NA	3.44E-07	mr1346_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500918476	NA	9.55E-07	mr1373_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500918476	5.32E-06	5.32E-06	mr1373_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500918476	NA	3.59E-06	mr1508_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500918476	NA	3.44E-06	mr1524_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500918476	9.46E-06	9.46E-06	mr1663_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500918476	2.52E-07	2.51E-07	mr1674_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500918476	4.17E-06	4.17E-06	mr1688_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500918476	3.14E-06	3.14E-06	mr1697_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500918476	9.78E-06	9.64E-06	mr1738_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500918476	NA	2.51E-07	mr1738_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500918476	NA	8.98E-06	mr1843_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500918476	1.94E-07	4.71E-13	mr1851_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251