\
| Variant ID: vg0500918476 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 918476 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TATCGGAGGAGAGGAGAAGGGGAGGAGAAGAACAGATAGAACCGGGAGGGAGGAGGGGAGGAGGAGATATGTATCTCGATCCCGCACGCCTCGATCTCTC[C/T]
GCGCATGCTGATCTTTTTTCTCGGTTGGTAACACCAACCAGGACTAAAGATTGATATTTAATCCCGATTGGTAACATCAACCGGGACTAAAGATATTAGA
TCTAATATCTTTAGTCCCGGTTGATGTTACCAATCGGGATTAAATATCAATCTTTAGTCCTGGTTGGTGTTACCAACCGAGAAAAAAGATCAGCATGCGC[G/A]
GAGAGATCGAGGCGTGCGGGATCGAGATACATATCTCCTCCTCCCCTCCTCCCTCCCGGTTCTATCTGTTCTTCTCCTCCCCTTCTCCTCTCCTCCGATA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.90% | 7.00% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 96.00% | 3.90% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 91.60% | 8.40% | 0.00% | 0.00% | NA |
| Aus | 269 | 67.30% | 32.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.20% | 1.80% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 92.20% | 7.70% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 96.40% | 3.30% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 78.40% | 21.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 92.90% | 7.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 91.10% | 8.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0500918476 | C -> T | LOC_Os05g02630.1 | upstream_gene_variant ; 1116.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0500918476 | C -> T | LOC_Os05g02640.1 | upstream_gene_variant ; 3561.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0500918476 | C -> T | LOC_Os05g02620.1 | downstream_gene_variant ; 4730.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0500918476 | C -> T | LOC_Os05g02620-LOC_Os05g02630 | intergenic_region ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0500918476 | 9.84E-06 | 9.83E-06 | mr1261 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0500918476 | NA | 7.91E-06 | mr1245_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0500918476 | 7.75E-06 | 7.75E-06 | mr1312_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0500918476 | NA | 3.44E-07 | mr1346_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0500918476 | NA | 9.55E-07 | mr1373_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0500918476 | 5.32E-06 | 5.32E-06 | mr1373_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0500918476 | NA | 3.59E-06 | mr1508_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0500918476 | NA | 3.44E-06 | mr1524_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0500918476 | 9.46E-06 | 9.46E-06 | mr1663_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0500918476 | 2.52E-07 | 2.51E-07 | mr1674_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0500918476 | 4.17E-06 | 4.17E-06 | mr1688_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0500918476 | 3.14E-06 | 3.14E-06 | mr1697_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0500918476 | 9.78E-06 | 9.64E-06 | mr1738_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0500918476 | NA | 2.51E-07 | mr1738_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0500918476 | NA | 8.98E-06 | mr1843_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0500918476 | 1.94E-07 | 4.71E-13 | mr1851_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |