Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0500913831:

Variant ID: vg0500913831 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 913831
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCGATAAATTTTCTCTTAAAAATTTGACAGATGTAATTATAGTACAATCGTAGTGTAATTATACTGTAACTTATATAATTACACTGTAACTTGCATGTAA[C/T]
TACAGTGTAACTTGTATATAAGTTTCACGTAATTTTGAATCGTTAAATCTATTACAAGATTTGTTTTGGTGAGGAAAAAAAATCATAACACATACATATG

Reverse complement sequence

CATATGTATGTGTTATGATTTTTTTTCCTCACCAAAACAAATCTTGTAATAGATTTAACGATTCAAAATTACGTGAAACTTATATACAAGTTACACTGTA[G/A]
TTACATGCAAGTTACAGTGTAATTATATAAGTTACAGTATAATTACACTACGATTGTACTATAATTACATCTGTCAAATTTTTAAGAGAAAATTTATCGA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	92.90%	7.10%	0.02%	0.00%	NA
All Indica	2759	96.00%	4.00%	0.04%	0.00%	NA
All Japonica	1512	91.70%	8.30%	0.00%	0.00%	NA
Aus	269	66.90%	33.10%	0.00%	0.00%	NA
Indica I	595	98.00%	2.00%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	92.20%	7.80%	0.00%	0.00%	NA
Indica Intermediate	786	96.60%	3.30%	0.13%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	78.20%	21.80%	0.00%	0.00%	NA
Japonica Intermediate	241	93.40%	6.60%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	90.00%	10.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0500913831	C -> T	LOC_Os05g02610.1	downstream_gene_variant ; 3305.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0500913831	C -> T	LOC_Os05g02620.1	downstream_gene_variant ; 85.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0500913831	C -> T	LOC_Os05g02620-LOC_Os05g02630	intergenic_region ; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0500913831	3.22E-06	NA	mr1261	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500913831	NA	4.83E-07	mr1346_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500913831	NA	3.85E-06	mr1373_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500913831	5.44E-06	5.44E-06	mr1427_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500913831	NA	8.05E-06	mr1524_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500913831	8.27E-07	8.26E-07	mr1674_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500913831	5.86E-06	5.85E-06	mr1697_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500913831	NA	2.27E-06	mr1738_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500913831	4.68E-07	9.96E-13	mr1851_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251