Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0500913433:

Variant ID: vg0500913433 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 913433
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCAAGCCGCCGCCATCTTACCATCTTTCCTAAGTTTTTTTTTTATTAAGAACGACCATCTTTAATAAGTGGAAAGCTTATATACTCCCTCCGTTTTTTTA[A/C]
TAGATGACGCCGTTGACTTTTTCTTACATGTTTGACCATTCGTCTCATTCAAAAATTTTATGCAAATGTATAAGATATAAATCACACTTAAACTACTATG

Reverse complement sequence

CATAGTAGTTTAAGTGTGATTTATATCTTATACATTTGCATAAAATTTTTGAATGAGACGAATGGTCAAACATGTAAGAAAAAGTCAACGGCGTCATCTA[T/G]
TAAAAAAACGGAGGGAGTATATAAGCTTTCCACTTATTAAAGATGGTCGTTCTTAATAAAAAAAAAACTTAGGAAAGATGGTAAGATGGCGGCGGCTTGC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.60% 7.00% 0.80% 4.57% NA
All Indica  2759 93.20% 3.90% 0.58% 2.28% NA
All Japonica  1512 91.60% 8.30% 0.07% 0.07% NA
Aus  269 6.30% 32.70% 7.81% 53.16% NA
Indica I  595 97.80% 1.80% 0.00% 0.34% NA
Indica II  465 97.00% 0.00% 1.29% 1.72% NA
Indica III  913 89.30% 7.80% 0.55% 2.41% NA
Indica Intermediate  786 92.10% 3.30% 0.64% 3.94% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 78.20% 21.80% 0.00% 0.00% NA
Japonica Intermediate  241 92.90% 6.20% 0.41% 0.41% NA
VI/Aromatic  96 90.60% 1.00% 0.00% 8.33% NA
Intermediate  90 90.00% 8.90% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0500913433 A -> DEL N N silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0500913433 A -> C LOC_Os05g02620.1 3_prime_UTR_variant ; 69.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0500913433 A -> C LOC_Os05g02610.1 downstream_gene_variant ; 2907.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0500913433 A C -0.09 0.01 0.0 -0.01 -0.02 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0500913433 NA 7.13E-06 mr1177 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500913433 9.52E-06 9.52E-06 mr1192_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500913433 NA 1.97E-06 mr1346_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500913433 NA 3.91E-06 mr1373_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500913433 2.21E-06 2.21E-06 mr1427_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500913433 1.08E-06 1.08E-06 mr1674_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500913433 NA 2.27E-06 mr1738_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500913433 5.22E-06 1.52E-11 mr1851_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251