\
| Variant ID: vg0500906389 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 906389 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.94, A: 0.07, others allele: 0.00, population size: 218. )
GAAGAAATCATGCATCCTGCTCATCGACTTAGCTTGCATGCATCAAACTGGAGCATTCCAGCTTGCAGTTAATTAGATCAGATTCGGAACCTTCTGTACT[T/A]
TTTTAGGACTCCAACTAGCTAGCAGTTAATTATATCATACTTGAATTTTTCTGTTCTTCTTTAGGACGCTCATCAACGTGGTGAAGCACTCTGATCCTGA
TCAGGATCAGAGTGCTTCACCACGTTGATGAGCGTCCTAAAGAAGAACAGAAAAATTCAAGTATGATATAATTAACTGCTAGCTAGTTGGAGTCCTAAAA[A/T]
AGTACAGAAGGTTCCGAATCTGATCTAATTAACTGCAAGCTGGAATGCTCCAGTTTGATGCATGCAAGCTAAGTCGATGAGCAGGATGCATGATTTCTTC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.60% | 8.40% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 90.60% | 9.40% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 92.10% | 7.90% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 88.60% | 11.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 88.40% | 11.60% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 88.80% | 11.10% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 78.60% | 21.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 95.00% | 5.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 90.60% | 9.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 91.10% | 8.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0500906389 | T -> A | LOC_Os05g02590.1 | upstream_gene_variant ; 1697.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0500906389 | T -> A | LOC_Os05g02610.1 | upstream_gene_variant ; 3279.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0500906389 | T -> A | LOC_Os05g02580.1 | downstream_gene_variant ; 3320.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0500906389 | T -> A | LOC_Os05g02600.1 | intron_variant ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0500906389 | NA | 3.64E-06 | mr1890 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0500906389 | 7.10E-06 | 7.10E-06 | mr1192_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0500906389 | 9.46E-07 | 2.88E-07 | mr1312_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0500906389 | 8.73E-06 | 8.72E-06 | mr1427_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0500906389 | NA | 9.91E-06 | mr1663_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0500906389 | 8.06E-06 | 4.79E-06 | mr1665_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0500906389 | 2.65E-06 | 9.29E-07 | mr1738_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0500906389 | NA | 2.18E-06 | mr1738_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0500906389 | NA | 2.69E-07 | mr1805_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0500906389 | 5.83E-06 | 5.82E-06 | mr1822_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0500906389 | 3.46E-06 | 3.46E-06 | mr1847_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0500906389 | NA | 3.22E-07 | mr1952_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |