\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0500885332:

Variant ID: vg0500885332 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 885332
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACGAACACCGGTGGCAAGCCGGGGAGGAAGTTGGCCGCGGACGCCGGCACTCGGCCGGTGCAGGGGCGCCACCCGCCGGGCTTTCCCAGGGTATACACCT[A/C]
GCAGACGTGCTCCCCGTTGCGTTTCTTGAAGAGCCTGACCACCTTGTGCTCGCCGGTCGCCGCGTCGAAGCCAAGCCCGGTGGTCGAGAGCTCGAAGGGG

Reverse complement sequence

CCCCTTCGAGCTCTCGACCACCGGGCTTGGCTTCGACGCGGCGACCGGCGAGCACAAGGTGGTCAGGCTCTTCAAGAAACGCAACGGGGAGCACGTCTGC[T/G]
AGGTGTATACCCTGGGAAAGCCCGGCGGGTGGCGCCCCTGCACCGGCCGAGTGCCGGCGTCCGCGGCCAACTTCCTCCCCGGCTTGCCACCGGTGTTCGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 46.90% 32.20% 0.42% 20.50% NA
All Indica  2759 61.80% 3.20% 0.62% 34.32% NA
All Japonica  1512 9.50% 90.20% 0.20% 0.07% NA
Aus  269 98.90% 0.40% 0.00% 0.74% NA
Indica I  595 72.30% 6.40% 0.50% 20.84% NA
Indica II  465 64.90% 4.50% 0.22% 30.32% NA
Indica III  913 46.70% 0.50% 0.44% 52.35% NA
Indica Intermediate  786 69.70% 3.20% 1.15% 25.95% NA
Temperate Japonica  767 0.70% 99.00% 0.39% 0.00% NA
Tropical Japonica  504 22.00% 77.80% 0.00% 0.20% NA
Japonica Intermediate  241 11.60% 88.40% 0.00% 0.00% NA
VI/Aromatic  96 65.60% 22.90% 0.00% 11.46% NA
Intermediate  90 42.20% 48.90% 0.00% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0500885332 A -> DEL N N silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0500885332 A -> C LOC_Os05g02550.1 splice_region_variant&intron_variant ; LOW silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0500885332 A -> C LOC_Os05g02530.1 upstream_gene_variant ; 4704.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0500885332 A -> C LOC_Os05g02560.1 upstream_gene_variant ; 4272.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0500885332 A -> C LOC_Os05g02540.1 downstream_gene_variant ; 730.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0500885332 A C -0.01 0.0 0.02 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0500885332 NA 3.39E-10 mr1198 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500885332 NA 3.66E-10 mr1275 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500885332 NA 1.21E-07 mr1646 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500885332 NA 7.29E-07 mr1690 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500885332 NA 2.07E-08 mr1776 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500885332 NA 6.50E-12 mr1846 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500885332 NA 1.49E-24 mr1917 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500885332 5.56E-07 3.39E-06 mr1038_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500885332 NA 4.36E-06 mr1200_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500885332 6.45E-09 6.45E-09 mr1389_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500885332 NA 6.44E-34 mr1448_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251