\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0500854181:

Variant ID: vg0500854181 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 854181
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, A: 0.01, others allele: 0.00, population size: 281. )

Flanking Sequence (100 bp) in Reference Genome:


TGGTAATTGTTCTTTTGGGTCAACTTACTAGCAAAATTCTGCTCGATTATACTAAATTGTTCATGAATTAAACACAAATCACCATTTTCCGTCCTGAATC[T/A]
ATGGTTGGAAAGTTATCAATGTTTGGATGCTGCACAAGGCTCAAAGTTCAATGTAAACAGGACCAAAAAAAAGGATTTCTGAACATTCGTCCTTTCATTC

Reverse complement sequence

GAATGAAAGGACGAATGTTCAGAAATCCTTTTTTTTGGTCCTGTTTACATTGAACTTTGAGCCTTGTGCAGCATCCAAACATTGATAACTTTCCAACCAT[A/T]
GATTCAGGACGGAAAATGGTGATTTGTGTTTAATTCATGAACAATTTAGTATAATCGAGCAGAATTTTGCTAGTAAGTTGACCCAAAAGAACAATTACCA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.60% 11.30% 0.08% 0.00% NA
All Indica  2759 89.30% 10.60% 0.14% 0.00% NA
All Japonica  1512 91.70% 8.30% 0.00% 0.00% NA
Aus  269 77.00% 23.00% 0.00% 0.00% NA
Indica I  595 98.00% 2.00% 0.00% 0.00% NA
Indica II  465 87.30% 12.70% 0.00% 0.00% NA
Indica III  913 86.90% 13.10% 0.00% 0.00% NA
Indica Intermediate  786 86.60% 12.80% 0.51% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 78.40% 21.60% 0.00% 0.00% NA
Japonica Intermediate  241 93.40% 6.60% 0.00% 0.00% NA
VI/Aromatic  96 53.10% 46.90% 0.00% 0.00% NA
Intermediate  90 87.80% 12.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0500854181 T -> A LOC_Os05g02480.1 downstream_gene_variant ; 3768.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0500854181 T -> A LOC_Os05g02500.1 downstream_gene_variant ; 4113.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0500854181 T -> A LOC_Os05g02500.2 downstream_gene_variant ; 4113.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0500854181 T -> A LOC_Os05g02500.3 downstream_gene_variant ; 4113.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0500854181 T -> A LOC_Os05g02490.1 intron_variant ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0500854181 7.32E-06 4.39E-08 mr1346 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500854181 NA 9.21E-06 mr1577 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500854181 NA 6.74E-06 mr1346_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500854181 NA 1.35E-06 mr1754_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251