\
| Variant ID: vg0500831115 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 831115 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.88, T: 0.12, others allele: 0.00, population size: 108. )
GCGAAATTCTATTGATAGAGCAGGAAAAAATTACAAGATTACAACCCTGGAGGGTCATAACCAGGAGAAAGAAAAAAATATACCACCACCCACACACCGG[C/T]
AGCGCCAACACACACGACCAGGAGAAGGTTAGCACCAGACCGGCCGCCGCTAGACCAACAAAGGAACACAGACGAGATCGCCCTACAGCAAGGGGGTGCC
GGCACCCCCTTGCTGTAGGGCGATCTCGTCTGTGTTCCTTTGTTGGTCTAGCGGCGGCCGGTCTGGTGCTAACCTTCTCCTGGTCGTGTGTGTTGGCGCT[G/A]
CCGGTGTGTGGGTGGTGGTATATTTTTTTCTTTCTCCTGGTTATGACCCTCCAGGGTTGTAATCTTGTAATTTTTTCCTGCTCTATCAATAGAATTTCGC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 88.70% | 11.20% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 89.90% | 10.10% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 91.60% | 8.40% | 0.00% | 0.00% | NA |
| Aus | 269 | 74.00% | 25.70% | 0.37% | 0.00% | NA |
| Indica I | 595 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 92.00% | 8.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 85.10% | 14.80% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 87.70% | 12.20% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 79.00% | 21.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 91.70% | 8.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 51.00% | 49.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 90.00% | 10.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0500831115 | C -> T | LOC_Os05g02450.1 | upstream_gene_variant ; 4479.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0500831115 | C -> T | LOC_Os05g02450.2 | upstream_gene_variant ; 4479.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0500831115 | C -> T | LOC_Os05g02435.1 | downstream_gene_variant ; 4975.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0500831115 | C -> T | LOC_Os05g02440.1 | downstream_gene_variant ; 337.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0500831115 | C -> T | LOC_Os05g02435-LOC_Os05g02440 | intergenic_region ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0500831115 | NA | 4.72E-07 | mr1578_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0500831115 | 2.28E-06 | 4.41E-07 | mr1754_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0500831115 | NA | 1.04E-07 | mr1754_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0500831115 | 5.94E-06 | 5.94E-06 | mr1819_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0500831115 | NA | 3.26E-06 | mr1952_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |