\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0500824098:

Variant ID: vg0500824098 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 824098
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.83, A: 0.16, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


GAAAAAAAAATTTATATATAAAAGTTACTTTAAAATCATACTCATCCGTTTTATATTATAAGACTTTCTAGCATTTACCTAGATTCATTAACATCTATAT[G/A]
AATATGGGCAATGCTAGAAAGTCTTATAACCTGAAACAGATGTAGTATTAATATTTTTTTCAAGCTTAAAATAATTAATATTTAATTAATTACGCACTAA

Reverse complement sequence

TTAGTGCGTAATTAATTAAATATTAATTATTTTAAGCTTGAAAAAAATATTAATACTACATCTGTTTCAGGTTATAAGACTTTCTAGCATTGCCCATATT[C/T]
ATATAGATGTTAATGAATCTAGGTAAATGCTAGAAAGTCTTATAATATAAAACGGATGAGTATGATTTTAAAGTAACTTTTATATATAAATTTTTTTTTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.00% 49.90% 0.06% 0.00% NA
All Indica  2759 45.10% 54.80% 0.11% 0.00% NA
All Japonica  1512 63.70% 36.30% 0.00% 0.00% NA
Aus  269 27.50% 72.50% 0.00% 0.00% NA
Indica I  595 31.30% 68.70% 0.00% 0.00% NA
Indica II  465 34.00% 66.00% 0.00% 0.00% NA
Indica III  913 66.50% 33.40% 0.11% 0.00% NA
Indica Intermediate  786 37.20% 62.60% 0.25% 0.00% NA
Temperate Japonica  767 87.00% 13.00% 0.00% 0.00% NA
Tropical Japonica  504 23.80% 76.20% 0.00% 0.00% NA
Japonica Intermediate  241 73.00% 27.00% 0.00% 0.00% NA
VI/Aromatic  96 36.50% 63.50% 0.00% 0.00% NA
Intermediate  90 55.60% 44.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0500824098 G -> A LOC_Os05g02435.1 3_prime_UTR_variant ; 954.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0500824098 G A 0.01 0.01 0.02 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0500824098 NA 1.67E-07 mr1194 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500824098 NA 7.51E-06 mr1295 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500824098 NA 1.75E-12 mr1580 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500824098 NA 4.07E-07 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500824098 NA 5.27E-12 mr1825 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500824098 NA 2.74E-06 mr1161_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500824098 NA 6.84E-06 mr1194_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500824098 NA 1.47E-11 mr1580_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500824098 NA 2.78E-12 mr1825_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500824098 NA 4.45E-06 mr1870_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251