| Variant ID: vg0500807732 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 807732 |
| Reference Allele: C | Alternative Allele: T,G |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.00, others allele: 0.00, population size: 309. )
TCCATGAAATAGCTCCTACTGCCAAGGTGAACACGTATCCCGATGTTAACTTTGTATTATCTTTTGCAAAGTCAAAATCTGAATACCCCACTATCTGGAG[C/T,G]
GATTCTGATTTTCTGTAAGACAGCATGAGGCCTTTTGTTCCTTGCAAATAACGCAAGACTTTCTATACCAATTTCCAGTGCTCTGGGCCTGGATTACTCT
AGAGTAATCCAGGCCCAGAGCACTGGAAATTGGTATAGAAAGTCTTGCGTTATTTGCAAGGAACAAAAGGCCTCATGCTGTCTTACAGAAAATCAGAATC[G/A,C]
CTCCAGATAGTGGGGTATTCAGATTTTGACTTTGCAAAAGATAATACAAAGTTAACATCGGGATACGTGTTCACCTTGGCAGTAGGAGCTATTTCATGGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 98.10% | 1.50% | 0.42% | 0.00% | NA |
| All Indica | 2759 | 99.90% | 0.10% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 94.20% | 4.60% | 1.19% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.40% | 0.40% | 0.22% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 88.80% | 8.90% | 2.35% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 1.10% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0500807732 | C -> T | LOC_Os05g02420.1 | downstream_gene_variant ; 4268.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0500807732 | C -> T | LOC_Os05g02430.1 | downstream_gene_variant ; 2276.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0500807732 | C -> T | LOC_Os05g02420.2 | downstream_gene_variant ; 4268.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0500807732 | C -> T | LOC_Os05g02420-LOC_Os05g02430 | intergenic_region ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0500807732 | C -> G | LOC_Os05g02420.1 | downstream_gene_variant ; 4268.0bp to feature; MODIFIER | N | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0500807732 | C -> G | LOC_Os05g02430.1 | downstream_gene_variant ; 2276.0bp to feature; MODIFIER | N | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0500807732 | C -> G | LOC_Os05g02420.2 | downstream_gene_variant ; 4268.0bp to feature; MODIFIER | N | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0500807732 | C -> G | LOC_Os05g02420-LOC_Os05g02430 | intergenic_region ; MODIFIER | N | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0500807732 | NA | 4.58E-06 | mr1060_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0500807732 | 4.06E-07 | 4.06E-07 | mr1186_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0500807732 | NA | 5.86E-06 | mr1359_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0500807732 | 4.44E-07 | 4.44E-07 | mr1499_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0500807732 | 5.30E-07 | 1.60E-08 | mr1576_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0500807732 | 6.82E-07 | 6.82E-07 | mr1616_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0500807732 | 4.83E-08 | 3.80E-07 | mr1712_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0500807732 | NA | 7.02E-07 | mr1977_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |