Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0500771205:

Variant ID: vg0500771205 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 771205
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GCAGAGGTTACTCCTGATAGTGCTAAGATGGGACGGGGCATACCTAACTCCACTCCGCCTGACATAGGGCGGAATATGGGGGCACTGCGGCCCGTCCAAT[C/A]
TCCTGTGACCAGTCATAGACCGGTCATGCCCGACTGACAGGGGTCAGTCGCGCTGCGCCGCACGTCCACCCACACCGCATTAAATGCGGTGAGGGATGGT

Reverse complement sequence

ACCATCCCTCACCGCATTTAATGCGGTGTGGGTGGACGTGCGGCGCAGCGCGACTGACCCCTGTCAGTCGGGCATGACCGGTCTATGACTGGTCACAGGA[G/T]
ATTGGACGGGCCGCAGTGCCCCCATATTCCGCCCTATGTCAGGCGGAGTGGAGTTAGGTATGCCCCGTCCCATCTTAGCACTATCAGGAGTAACCTCTGC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	95.30%	1.80%	0.28%	2.69%	NA
All Indica	2759	99.40%	0.10%	0.04%	0.51%	NA
All Japonica	1512	87.00%	5.10%	0.73%	7.14%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.60%	0.40%	0.00%	0.00%	NA
Indica III	913	98.90%	0.00%	0.00%	1.10%	NA
Indica Intermediate	786	99.40%	0.00%	0.13%	0.51%	NA
Temperate Japonica	767	89.40%	9.50%	1.04%	0.00%	NA
Tropical Japonica	504	79.80%	0.20%	0.40%	19.64%	NA
Japonica Intermediate	241	94.60%	1.20%	0.41%	3.73%	NA
VI/Aromatic	96	96.90%	0.00%	0.00%	3.12%	NA
Intermediate	90	92.20%	4.40%	1.11%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0500771205	C -> DEL	N	N	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0500771205	C -> A	LOC_Os05g02360.1	downstream_gene_variant ; 13.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0500771205	C -> A	LOC_Os05g02370.1	downstream_gene_variant ; 2108.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0500771205	C -> A	LOC_Os05g02350-LOC_Os05g02360	intergenic_region ; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0500771205	C	A	0.0	0.0	-0.01	0.0	0.0	0.0

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0500771205	NA	2.49E-06	mr1060_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500771205	6.97E-06	6.97E-06	mr1186_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500771205	NA	7.38E-07	mr1359_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500771205	NA	3.46E-06	mr1380_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500771205	5.34E-06	5.35E-06	mr1499_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500771205	1.33E-07	7.00E-09	mr1576_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500771205	1.98E-07	2.97E-07	mr1712_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500771205	NA	1.07E-06	mr1977_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251