Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0500744790:

Variant ID: vg0500744790 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 744790
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AACGATGAATCAAATGATAGGAAAATAATTAATAATTGTTTAATTTTTTTAAATAAGACAAATGATTAAATATGTTTAAAAATAATTAAAGGCGTAAAAT[T/A]
TTTAGCGACGGAGGAACTATATGTTACTGGAATTGTAGTATCCAATACTCTTGGACAGCATATGCCGATCGAATCGATATATATGCGATAGCTTCTCTTC

Reverse complement sequence

GAAGAGAAGCTATCGCATATATATCGATTCGATCGGCATATGCTGTCCAAGAGTATTGGATACTACAATTCCAGTAACATATAGTTCCTCCGTCGCTAAA[A/T]
ATTTTACGCCTTTAATTATTTTTAAACATATTTAATCATTTGTCTTATTTAAAAAAATTAAACAATTATTAATTATTTTCCTATCATTTGATTCATCGTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.90% 39.30% 2.92% 8.87% NA
All Indica  2759 29.40% 55.10% 4.78% 10.73% NA
All Japonica  1512 88.90% 3.30% 0.26% 7.54% NA
Aus  269 11.90% 88.10% 0.00% 0.00% NA
Indica I  595 2.70% 79.70% 7.56% 10.08% NA
Indica II  465 25.80% 53.80% 4.95% 15.48% NA
Indica III  913 52.70% 35.60% 2.74% 8.98% NA
Indica Intermediate  786 24.80% 59.80% 4.96% 10.43% NA
Temperate Japonica  767 94.90% 4.80% 0.13% 0.13% NA
Tropical Japonica  504 79.20% 0.00% 0.40% 20.44% NA
Japonica Intermediate  241 90.00% 5.40% 0.41% 4.15% NA
VI/Aromatic  96 76.00% 22.90% 0.00% 1.04% NA
Intermediate  90 55.60% 33.30% 2.22% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0500744790 T -> DEL N N silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0500744790 T -> A LOC_Os05g02310.1 upstream_gene_variant ; 1824.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0500744790 T -> A LOC_Os05g02320.1 upstream_gene_variant ; 3294.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0500744790 T -> A LOC_Os05g02310-LOC_Os05g02320 intergenic_region ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0500744790 T A -0.02 0.0 -0.01 -0.03 -0.04 -0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0500744790 NA 1.61E-17 mr1529 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500744790 NA 1.81E-23 mr1917 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500744790 NA 1.37E-22 mr1175_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500744790 NA 8.18E-39 mr1448_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500744790 NA 6.16E-26 mr1588_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500744790 NA 2.98E-17 mr1712_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500744790 NA 3.04E-11 mr1722_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500744790 NA 1.39E-10 mr1893_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251