\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0500741833:

Variant ID: vg0500741833 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 741833
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, T: 0.03, others allele: 0.00, population size: 163. )

Flanking Sequence (100 bp) in Reference Genome:


GATGGAGTACAAAGGTTCGTAATTAATTCCGTTTCAATATAAGTCCAGTTAATGAAATCAGAAATCCAGGAACAAGCTGAAAAAATGTCAAATTTTGAAG[G/T]
TAAAAAATGATTAACTGCACAAAAGAGATCATAGGACCCAATTGGCCCACCAAAAATCAATAAGAATTGGCAACACTAGAAATCATTGTCAATATTTTGT

Reverse complement sequence

ACAAAATATTGACAATGATTTCTAGTGTTGCCAATTCTTATTGATTTTTGGTGGGCCAATTGGGTCCTATGATCTCTTTTGTGCAGTTAATCATTTTTTA[C/A]
CTTCAAAATTTGACATTTTTTCAGCTTGTTCCTGGATTTCTGATTTCATTAACTGGACTTATATTGAAACGGAATTAATTACGAACCTTTGTACTCCATC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.00% 11.30% 5.88% 2.77% NA
All Indica  2759 73.10% 15.40% 7.29% 4.24% NA
All Japonica  1512 93.80% 0.60% 4.83% 0.79% NA
Aus  269 88.80% 11.20% 0.00% 0.00% NA
Indica I  595 97.80% 1.20% 0.84% 0.17% NA
Indica II  465 81.50% 6.90% 7.74% 3.87% NA
Indica III  913 47.60% 33.30% 11.83% 7.23% NA
Indica Intermediate  786 78.90% 10.40% 6.62% 4.07% NA
Temperate Japonica  767 99.50% 0.50% 0.00% 0.00% NA
Tropical Japonica  504 84.90% 0.20% 12.50% 2.38% NA
Japonica Intermediate  241 94.20% 1.70% 4.15% 0.00% NA
VI/Aromatic  96 32.30% 67.70% 0.00% 0.00% NA
Intermediate  90 87.80% 5.60% 4.44% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0500741833 G -> T LOC_Os05g02300.1 downstream_gene_variant ; 2754.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0500741833 G -> T LOC_Os05g02310.1 intron_variant ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0500741833 G -> DEL N N silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0500741833 NA 1.30E-06 mr1705 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500741833 NA 1.75E-06 mr1970 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500741833 NA 2.50E-07 mr1973 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500741833 8.98E-07 NA mr1970_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500741833 4.14E-06 5.41E-07 mr1970_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500741833 4.85E-06 NA mr1973_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500741833 NA 4.04E-08 mr1973_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251