\
| Variant ID: vg0500741833 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 741833 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, T: 0.03, others allele: 0.00, population size: 163. )
GATGGAGTACAAAGGTTCGTAATTAATTCCGTTTCAATATAAGTCCAGTTAATGAAATCAGAAATCCAGGAACAAGCTGAAAAAATGTCAAATTTTGAAG[G/T]
TAAAAAATGATTAACTGCACAAAAGAGATCATAGGACCCAATTGGCCCACCAAAAATCAATAAGAATTGGCAACACTAGAAATCATTGTCAATATTTTGT
ACAAAATATTGACAATGATTTCTAGTGTTGCCAATTCTTATTGATTTTTGGTGGGCCAATTGGGTCCTATGATCTCTTTTGTGCAGTTAATCATTTTTTA[C/A]
CTTCAAAATTTGACATTTTTTCAGCTTGTTCCTGGATTTCTGATTTCATTAACTGGACTTATATTGAAACGGAATTAATTACGAACCTTTGTACTCCATC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 80.00% | 11.30% | 5.88% | 2.77% | NA |
| All Indica | 2759 | 73.10% | 15.40% | 7.29% | 4.24% | NA |
| All Japonica | 1512 | 93.80% | 0.60% | 4.83% | 0.79% | NA |
| Aus | 269 | 88.80% | 11.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.80% | 1.20% | 0.84% | 0.17% | NA |
| Indica II | 465 | 81.50% | 6.90% | 7.74% | 3.87% | NA |
| Indica III | 913 | 47.60% | 33.30% | 11.83% | 7.23% | NA |
| Indica Intermediate | 786 | 78.90% | 10.40% | 6.62% | 4.07% | NA |
| Temperate Japonica | 767 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 84.90% | 0.20% | 12.50% | 2.38% | NA |
| Japonica Intermediate | 241 | 94.20% | 1.70% | 4.15% | 0.00% | NA |
| VI/Aromatic | 96 | 32.30% | 67.70% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 87.80% | 5.60% | 4.44% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0500741833 | G -> T | LOC_Os05g02300.1 | downstream_gene_variant ; 2754.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0500741833 | G -> T | LOC_Os05g02310.1 | intron_variant ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0500741833 | G -> DEL | N | N | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0500741833 | NA | 1.30E-06 | mr1705 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0500741833 | NA | 1.75E-06 | mr1970 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0500741833 | NA | 2.50E-07 | mr1973 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0500741833 | 8.98E-07 | NA | mr1970_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0500741833 | 4.14E-06 | 5.41E-07 | mr1970_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0500741833 | 4.85E-06 | NA | mr1973_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0500741833 | NA | 4.04E-08 | mr1973_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |