Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0500741833:

Variant ID: vg0500741833 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 741833
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, T: 0.03, others allele: 0.00, population size: 163. )

Flanking Sequence (100 bp) in Reference Genome:

GATGGAGTACAAAGGTTCGTAATTAATTCCGTTTCAATATAAGTCCAGTTAATGAAATCAGAAATCCAGGAACAAGCTGAAAAAATGTCAAATTTTGAAG[G/T]
TAAAAAATGATTAACTGCACAAAAGAGATCATAGGACCCAATTGGCCCACCAAAAATCAATAAGAATTGGCAACACTAGAAATCATTGTCAATATTTTGT

Reverse complement sequence

ACAAAATATTGACAATGATTTCTAGTGTTGCCAATTCTTATTGATTTTTGGTGGGCCAATTGGGTCCTATGATCTCTTTTGTGCAGTTAATCATTTTTTA[C/A]
CTTCAAAATTTGACATTTTTTCAGCTTGTTCCTGGATTTCTGATTTCATTAACTGGACTTATATTGAAACGGAATTAATTACGAACCTTTGTACTCCATC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	80.00%	11.30%	5.88%	2.77%	NA
All Indica	2759	73.10%	15.40%	7.29%	4.24%	NA
All Japonica	1512	93.80%	0.60%	4.83%	0.79%	NA
Aus	269	88.80%	11.20%	0.00%	0.00%	NA
Indica I	595	97.80%	1.20%	0.84%	0.17%	NA
Indica II	465	81.50%	6.90%	7.74%	3.87%	NA
Indica III	913	47.60%	33.30%	11.83%	7.23%	NA
Indica Intermediate	786	78.90%	10.40%	6.62%	4.07%	NA
Temperate Japonica	767	99.50%	0.50%	0.00%	0.00%	NA
Tropical Japonica	504	84.90%	0.20%	12.50%	2.38%	NA
Japonica Intermediate	241	94.20%	1.70%	4.15%	0.00%	NA
VI/Aromatic	96	32.30%	67.70%	0.00%	0.00%	NA
Intermediate	90	87.80%	5.60%	4.44%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0500741833	G -> T	LOC_Os05g02300.1	downstream_gene_variant ; 2754.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0500741833	G -> T	LOC_Os05g02310.1	intron_variant ; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0500741833	G -> DEL	N	N	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0500741833	NA	1.30E-06	mr1705	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500741833	NA	1.75E-06	mr1970	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500741833	NA	2.50E-07	mr1973	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500741833	8.98E-07	NA	mr1970_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500741833	4.14E-06	5.41E-07	mr1970_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500741833	4.85E-06	NA	mr1973_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500741833	NA	4.04E-08	mr1973_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251