\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0500739274:

Variant ID: vg0500739274 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 739274
Reference Allele: GAlternative Allele: C
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACTTGTTCATTCCAAAATGAACTTTACCTAATTTTAGTCTTTTTTTTTGTAGAGTAACAAACTAAACAAGTTTTTACTATTCCAAACTTAAACAGAATTT[G/C]
ATAATTGTAGAGTCTTCCACTCACAAAACTTCATCAACACTTGGTAAGTATCAAAATTTGGCATTGCCACTTTTGCTTTACCAACAAATGGTAAGGTTTA

Reverse complement sequence

TAAACCTTACCATTTGTTGGTAAAGCAAAAGTGGCAATGCCAAATTTTGATACTTACCAAGTGTTGATGAAGTTTTGTGAGTGGAAGACTCTACAATTAT[C/G]
AAATTCTGTTTAAGTTTGGAATAGTAAAAACTTGTTTAGTTTGTTACTCTACAAAAAAAAAGACTAAAATTAGGTAAAGTTCATTTTGGAATGAACAAGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.80% 11.20% 0.02% 0.00% NA
All Indica  2759 84.70% 15.30% 0.00% 0.00% NA
All Japonica  1512 99.40% 0.50% 0.07% 0.00% NA
Aus  269 89.60% 10.40% 0.00% 0.00% NA
Indica I  595 99.00% 1.00% 0.00% 0.00% NA
Indica II  465 93.10% 6.90% 0.00% 0.00% NA
Indica III  913 66.70% 33.30% 0.00% 0.00% NA
Indica Intermediate  786 89.70% 10.30% 0.00% 0.00% NA
Temperate Japonica  767 99.50% 0.40% 0.13% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 98.30% 1.70% 0.00% 0.00% NA
VI/Aromatic  96 33.30% 66.70% 0.00% 0.00% NA
Intermediate  90 94.40% 5.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0500739274 G -> C LOC_Os05g02290.1 downstream_gene_variant ; 3996.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0500739274 G -> C LOC_Os05g02300.1 downstream_gene_variant ; 195.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0500739274 G -> C LOC_Os05g02310.1 downstream_gene_variant ; 372.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0500739274 G -> C LOC_Os05g02300-LOC_Os05g02310 intergenic_region ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0500739274 NA 2.09E-06 mr1705 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500739274 NA 7.29E-07 mr1970 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500739274 NA 6.45E-08 mr1973 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500739274 3.92E-07 NA mr1970_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500739274 7.95E-06 7.36E-08 mr1970_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500739274 5.65E-06 NA mr1973_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500739274 NA 4.49E-09 mr1973_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251