\
| Variant ID: vg0500728234 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 728234 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CAATGCCCAAGCCATGAATGCTTTGTTCAACTCTTTGAGCCAAGAGGAGTTCGATAGAGTGAGCAACCTTGAGACCGCATATGAGATTTAGAACAAGTTG[A/G]
CGGAGATCCATGAGGGCACAAGCGAGTACAAGGATGCCAAGCTTCATTTCCTCAATATCCAATATGAGACATTCTCCATGTTGCCTCATGAGAGTGTGAA
TTCACACTCTCATGAGGCAACATGGAGAATGTCTCATATTGGATATTGAGGAAATGAAGCTTGGCATCCTTGTACTCGCTTGTGCCCTCATGGATCTCCG[T/C]
CAACTTGTTCTAAATCTCATATGCGGTCTCAAGGTTGCTCACTCTATCGAACTCCTCTTGGCTCAAAGAGTTGAACAAAGCATTCATGGCTTGGGCATTG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 46.80% | 31.10% | 13.29% | 8.80% | NA |
| All Indica | 2759 | 67.20% | 3.20% | 21.53% | 8.12% | NA |
| All Japonica | 1512 | 4.40% | 87.40% | 0.20% | 8.00% | NA |
| Aus | 269 | 88.10% | 1.10% | 5.95% | 4.83% | NA |
| Indica I | 595 | 97.10% | 0.70% | 1.18% | 1.01% | NA |
| Indica II | 465 | 72.50% | 5.80% | 10.75% | 10.97% | NA |
| Indica III | 913 | 39.40% | 3.30% | 45.89% | 11.39% | NA |
| Indica Intermediate | 786 | 73.50% | 3.40% | 15.01% | 8.02% | NA |
| Temperate Japonica | 767 | 6.80% | 92.70% | 0.13% | 0.39% | NA |
| Tropical Japonica | 504 | 0.00% | 79.00% | 0.20% | 20.83% | NA |
| Japonica Intermediate | 241 | 5.80% | 88.40% | 0.41% | 5.39% | NA |
| VI/Aromatic | 96 | 24.00% | 12.50% | 12.50% | 51.04% | NA |
| Intermediate | 90 | 35.60% | 51.10% | 3.33% | 10.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0500728234 | A -> DEL | LOC_Os05g02270.1 | N | frameshift_variant | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0500728234 | A -> G | LOC_Os05g02270.1 | missense_variant ; p.Thr85Ala; MODERATE | nonsynonymous_codon ; T85A | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | unknown | unknown | TOLERATED | 1.00 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0500728234 | NA | 1.89E-07 | mr1321_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0500728234 | NA | 6.86E-26 | mr1588_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0500728234 | NA | 1.01E-08 | mr1645_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0500728234 | NA | 1.34E-16 | mr1712_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0500728234 | 7.87E-06 | 1.95E-14 | mr1722_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0500728234 | NA | 4.82E-10 | mr1756_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0500728234 | NA | 4.48E-11 | mr1893_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |