Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0500723383:

Variant ID: vg0500723383 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 723383
Reference Allele: T	Alternative Allele: G
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.86, G: 0.14, others allele: 0.00, population size: 159. )

Flanking Sequence (100 bp) in Reference Genome:

AGCAATGATTATATAGACGTTTAATAGCATAGCCGATCAGATAGATCTAGCATGTATCGGCTAATACTCCGATACCACTTTATACTAAGATATTAAAACA[T/G]
GCAAAATATATTAAACAAGAAGCCTAATATACCTTAATGCAATAAGATATTAACATAAAGGGCAGACCTAGCATATCAATCAAGCATATGAGATATAAAG

Reverse complement sequence

CTTTATATCTCATATGCTTGATTGATATGCTAGGTCTGCCCTTTATGTTAATATCTTATTGCATTAAGGTATATTAGGCTTCTTGTTTAATATATTTTGC[A/C]
TGTTTTAATATCTTAGTATAAAGTGGTATCGGAGTATTAGCCGATACATGCTAGATCTATCTGATCGGCTATGCTATTAAACGTCTATATAATCATTGCT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	80.40%	12.40%	7.19%	0.00%	NA
All Indica	2759	73.90%	16.30%	9.79%	0.00%	NA
All Japonica	1512	92.90%	3.60%	3.51%	0.00%	NA
Aus	269	89.60%	8.60%	1.86%	0.00%	NA
Indica I	595	98.30%	0.50%	1.18%	0.00%	NA
Indica II	465	81.30%	10.30%	8.39%	0.00%	NA
Indica III	913	48.60%	34.20%	17.20%	0.00%	NA
Indica Intermediate	786	80.50%	10.90%	8.52%	0.00%	NA
Temperate Japonica	767	99.90%	0.00%	0.13%	0.00%	NA
Tropical Japonica	504	81.50%	9.30%	9.13%	0.00%	NA
Japonica Intermediate	241	94.60%	2.90%	2.49%	0.00%	NA
VI/Aromatic	96	35.40%	58.30%	6.25%	0.00%	NA
Intermediate	90	88.90%	4.40%	6.67%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0500723383	T -> G	LOC_Os05g02260.1	upstream_gene_variant ; 1515.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0500723383	T -> G	LOC_Os05g02270.1	upstream_gene_variant ; 4566.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0500723383	T -> G	LOC_Os05g02260.2	upstream_gene_variant ; 1515.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0500723383	T -> G	LOC_Os05g02260.3	upstream_gene_variant ; 1515.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0500723383	T -> G	LOC_Os05g02260.4	upstream_gene_variant ; 1515.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0500723383	T -> G	LOC_Os05g02250.1	downstream_gene_variant ; 4485.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0500723383	T -> G	LOC_Os05g02260-LOC_Os05g02270	intergenic_region ; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0500723383	2.22E-06	2.22E-06	mr1261	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500723383	NA	8.59E-06	mr1890	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500723383	4.10E-06	4.10E-06	mr1427_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500723383	NA	2.33E-06	mr1738_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251