\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0500723383:

Variant ID: vg0500723383 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 723383
Reference Allele: TAlternative Allele: G
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.86, G: 0.14, others allele: 0.00, population size: 159. )

Flanking Sequence (100 bp) in Reference Genome:


AGCAATGATTATATAGACGTTTAATAGCATAGCCGATCAGATAGATCTAGCATGTATCGGCTAATACTCCGATACCACTTTATACTAAGATATTAAAACA[T/G]
GCAAAATATATTAAACAAGAAGCCTAATATACCTTAATGCAATAAGATATTAACATAAAGGGCAGACCTAGCATATCAATCAAGCATATGAGATATAAAG

Reverse complement sequence

CTTTATATCTCATATGCTTGATTGATATGCTAGGTCTGCCCTTTATGTTAATATCTTATTGCATTAAGGTATATTAGGCTTCTTGTTTAATATATTTTGC[A/C]
TGTTTTAATATCTTAGTATAAAGTGGTATCGGAGTATTAGCCGATACATGCTAGATCTATCTGATCGGCTATGCTATTAAACGTCTATATAATCATTGCT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.40% 12.40% 7.19% 0.00% NA
All Indica  2759 73.90% 16.30% 9.79% 0.00% NA
All Japonica  1512 92.90% 3.60% 3.51% 0.00% NA
Aus  269 89.60% 8.60% 1.86% 0.00% NA
Indica I  595 98.30% 0.50% 1.18% 0.00% NA
Indica II  465 81.30% 10.30% 8.39% 0.00% NA
Indica III  913 48.60% 34.20% 17.20% 0.00% NA
Indica Intermediate  786 80.50% 10.90% 8.52% 0.00% NA
Temperate Japonica  767 99.90% 0.00% 0.13% 0.00% NA
Tropical Japonica  504 81.50% 9.30% 9.13% 0.00% NA
Japonica Intermediate  241 94.60% 2.90% 2.49% 0.00% NA
VI/Aromatic  96 35.40% 58.30% 6.25% 0.00% NA
Intermediate  90 88.90% 4.40% 6.67% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0500723383 T -> G LOC_Os05g02260.1 upstream_gene_variant ; 1515.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0500723383 T -> G LOC_Os05g02270.1 upstream_gene_variant ; 4566.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0500723383 T -> G LOC_Os05g02260.2 upstream_gene_variant ; 1515.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0500723383 T -> G LOC_Os05g02260.3 upstream_gene_variant ; 1515.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0500723383 T -> G LOC_Os05g02260.4 upstream_gene_variant ; 1515.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0500723383 T -> G LOC_Os05g02250.1 downstream_gene_variant ; 4485.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0500723383 T -> G LOC_Os05g02260-LOC_Os05g02270 intergenic_region ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0500723383 2.22E-06 2.22E-06 mr1261 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500723383 NA 8.59E-06 mr1890 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500723383 4.10E-06 4.10E-06 mr1427_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500723383 NA 2.33E-06 mr1738_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251