\
| Variant ID: vg0500723383 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 723383 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.86, G: 0.14, others allele: 0.00, population size: 159. )
AGCAATGATTATATAGACGTTTAATAGCATAGCCGATCAGATAGATCTAGCATGTATCGGCTAATACTCCGATACCACTTTATACTAAGATATTAAAACA[T/G]
GCAAAATATATTAAACAAGAAGCCTAATATACCTTAATGCAATAAGATATTAACATAAAGGGCAGACCTAGCATATCAATCAAGCATATGAGATATAAAG
CTTTATATCTCATATGCTTGATTGATATGCTAGGTCTGCCCTTTATGTTAATATCTTATTGCATTAAGGTATATTAGGCTTCTTGTTTAATATATTTTGC[A/C]
TGTTTTAATATCTTAGTATAAAGTGGTATCGGAGTATTAGCCGATACATGCTAGATCTATCTGATCGGCTATGCTATTAAACGTCTATATAATCATTGCT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 80.40% | 12.40% | 7.19% | 0.00% | NA |
| All Indica | 2759 | 73.90% | 16.30% | 9.79% | 0.00% | NA |
| All Japonica | 1512 | 92.90% | 3.60% | 3.51% | 0.00% | NA |
| Aus | 269 | 89.60% | 8.60% | 1.86% | 0.00% | NA |
| Indica I | 595 | 98.30% | 0.50% | 1.18% | 0.00% | NA |
| Indica II | 465 | 81.30% | 10.30% | 8.39% | 0.00% | NA |
| Indica III | 913 | 48.60% | 34.20% | 17.20% | 0.00% | NA |
| Indica Intermediate | 786 | 80.50% | 10.90% | 8.52% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.00% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 81.50% | 9.30% | 9.13% | 0.00% | NA |
| Japonica Intermediate | 241 | 94.60% | 2.90% | 2.49% | 0.00% | NA |
| VI/Aromatic | 96 | 35.40% | 58.30% | 6.25% | 0.00% | NA |
| Intermediate | 90 | 88.90% | 4.40% | 6.67% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0500723383 | T -> G | LOC_Os05g02260.1 | upstream_gene_variant ; 1515.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0500723383 | T -> G | LOC_Os05g02270.1 | upstream_gene_variant ; 4566.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0500723383 | T -> G | LOC_Os05g02260.2 | upstream_gene_variant ; 1515.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0500723383 | T -> G | LOC_Os05g02260.3 | upstream_gene_variant ; 1515.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0500723383 | T -> G | LOC_Os05g02260.4 | upstream_gene_variant ; 1515.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0500723383 | T -> G | LOC_Os05g02250.1 | downstream_gene_variant ; 4485.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0500723383 | T -> G | LOC_Os05g02260-LOC_Os05g02270 | intergenic_region ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0500723383 | 2.22E-06 | 2.22E-06 | mr1261 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0500723383 | NA | 8.59E-06 | mr1890 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0500723383 | 4.10E-06 | 4.10E-06 | mr1427_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0500723383 | NA | 2.33E-06 | mr1738_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |