\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0500663400:

Variant ID: vg0500663400 (JBrowse)Variation Type: INDEL
Chromosome: chr05Position: 663400
Reference Allele: TAlternative Allele: C,TCCTCTAC
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:


GTACAAGCTAGGGTTGGGTGTCCTTACTCTCCCTTCTTTTTTTTCCTCACTGGACGTCCACTCCCCTTTTATACTTTAAGGGGTTATTACATGAGTTCTA[T/C,TCCTCTAC]
GCGTCCTCTAGTAAGAGAAGAAACATCCTCTAGATTGAACGCGTGTCTCGCGCTGCATGCGCTACAGCTTGGAAATTCCCTACATCAGTAGTCGAGCGGG

Reverse complement sequence

CCCGCTCGACTACTGATGTAGGGAATTTCCAAGCTGTAGCGCATGCAGCGCGAGACACGCGTTCAATCTAGAGGATGTTTCTTCTCTTACTAGAGGACGC[A/G,GTAGAGGA]
TAGAACTCATGTAATAACCCCTTAAAGTATAAAAGGGGAGTGGACGTCCAGTGAGGAAAAAAAAGAAGGGAGAGTAAGGACACCCAACCCTAGCTTGTAC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.10% 33.70% 0.34% 0.00% TCCTCTAC: 1.88%
All Indica  2759 55.70% 43.40% 0.36% 0.00% TCCTCTAC: 0.54%
All Japonica  1512 91.30% 8.50% 0.13% 0.00% NA
Aus  269 11.90% 61.00% 1.12% 0.00% TCCTCTAC: 26.02%
Indica I  595 79.80% 19.70% 0.50% 0.00% NA
Indica II  465 74.80% 23.40% 0.00% 0.00% TCCTCTAC: 1.72%
Indica III  913 25.00% 74.80% 0.11% 0.00% TCCTCTAC: 0.11%
Indica Intermediate  786 61.80% 36.60% 0.76% 0.00% TCCTCTAC: 0.76%
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 78.60% 21.20% 0.20% 0.00% NA
Japonica Intermediate  241 90.90% 8.70% 0.41% 0.00% NA
VI/Aromatic  96 13.50% 85.40% 1.04% 0.00% NA
Intermediate  90 72.20% 23.30% 0.00% 0.00% TCCTCTAC: 4.44%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0500663400 T -> TCCTCTAC LOC_Os05g02150.1 upstream_gene_variant ; 3146.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0500663400 T -> TCCTCTAC LOC_Os05g02150-LOC_Os05g02160 intergenic_region ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0500663400 T -> C LOC_Os05g02150.1 upstream_gene_variant ; 3145.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0500663400 T -> C LOC_Os05g02150-LOC_Os05g02160 intergenic_region ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0500663400 NA 6.68E-06 mr1195 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500663400 NA 1.63E-06 mr1306 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500663400 NA 5.81E-10 mr1352 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500663400 NA 9.96E-09 mr1546 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500663400 NA 9.97E-09 mr1570 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500663400 NA 4.60E-06 mr1740 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500663400 NA 2.25E-06 mr1751 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500663400 NA 1.28E-07 mr1803 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500663400 NA 1.61E-07 mr1792_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251