\
| Variant ID: vg0500663400 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr05 | Position: 663400 |
| Reference Allele: T | Alternative Allele: C,TCCTCTAC |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 236. )
GTACAAGCTAGGGTTGGGTGTCCTTACTCTCCCTTCTTTTTTTTCCTCACTGGACGTCCACTCCCCTTTTATACTTTAAGGGGTTATTACATGAGTTCTA[T/C,TCCTCTAC]
GCGTCCTCTAGTAAGAGAAGAAACATCCTCTAGATTGAACGCGTGTCTCGCGCTGCATGCGCTACAGCTTGGAAATTCCCTACATCAGTAGTCGAGCGGG
CCCGCTCGACTACTGATGTAGGGAATTTCCAAGCTGTAGCGCATGCAGCGCGAGACACGCGTTCAATCTAGAGGATGTTTCTTCTCTTACTAGAGGACGC[A/G,GTAGAGGA]
TAGAACTCATGTAATAACCCCTTAAAGTATAAAAGGGGAGTGGACGTCCAGTGAGGAAAAAAAAGAAGGGAGAGTAAGGACACCCAACCCTAGCTTGTAC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 64.10% | 33.70% | 0.34% | 0.00% | TCCTCTAC: 1.88% |
| All Indica | 2759 | 55.70% | 43.40% | 0.36% | 0.00% | TCCTCTAC: 0.54% |
| All Japonica | 1512 | 91.30% | 8.50% | 0.13% | 0.00% | NA |
| Aus | 269 | 11.90% | 61.00% | 1.12% | 0.00% | TCCTCTAC: 26.02% |
| Indica I | 595 | 79.80% | 19.70% | 0.50% | 0.00% | NA |
| Indica II | 465 | 74.80% | 23.40% | 0.00% | 0.00% | TCCTCTAC: 1.72% |
| Indica III | 913 | 25.00% | 74.80% | 0.11% | 0.00% | TCCTCTAC: 0.11% |
| Indica Intermediate | 786 | 61.80% | 36.60% | 0.76% | 0.00% | TCCTCTAC: 0.76% |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 78.60% | 21.20% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 90.90% | 8.70% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 13.50% | 85.40% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 72.20% | 23.30% | 0.00% | 0.00% | TCCTCTAC: 4.44% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0500663400 | T -> TCCTCTAC | LOC_Os05g02150.1 | upstream_gene_variant ; 3146.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0500663400 | T -> TCCTCTAC | LOC_Os05g02150-LOC_Os05g02160 | intergenic_region ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0500663400 | T -> C | LOC_Os05g02150.1 | upstream_gene_variant ; 3145.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0500663400 | T -> C | LOC_Os05g02150-LOC_Os05g02160 | intergenic_region ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0500663400 | NA | 6.68E-06 | mr1195 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0500663400 | NA | 1.63E-06 | mr1306 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0500663400 | NA | 5.81E-10 | mr1352 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0500663400 | NA | 9.96E-09 | mr1546 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0500663400 | NA | 9.97E-09 | mr1570 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0500663400 | NA | 4.60E-06 | mr1740 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0500663400 | NA | 2.25E-06 | mr1751 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0500663400 | NA | 1.28E-07 | mr1803 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0500663400 | NA | 1.61E-07 | mr1792_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |