\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0500589004:

Variant ID: vg0500589004 (JBrowse)Variation Type: INDEL
Chromosome: chr05Position: 589004
Reference Allele: CAlternative Allele: T,A,CAAA,CA,CAA
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TATGTTCAACTTAAAGAACATTTGATGACGAATCAAGTCACAATAAAATAAATGATAGTTACATAAATTTTTTGAACAAGACGAATGGTCAAATATTAGA[C/T,A,CAAA,CA,CAA]
AAAAAATTAACGACGTCATACATTAAAATATGGAGGTAGTACGATATTTATATGAAGCTTATCTCTCTCTGTATGTATGCCGCACGGTTAGCTTGGAGTA

Reverse complement sequence

TACTCCAAGCTAACCGTGCGGCATACATACAGAGAGAGATAAGCTTCATATAAATATCGTACTACCTCCATATTTTAATGTATGACGTCGTTAATTTTTT[G/A,T,TTTG,TG,TTG]
TCTAATATTTGACCATTCGTCTTGTTCAAAAAATTTATGTAACTATCATTTATTTTATTGTGACTTGATTCGTCATCAAATGTTCTTTAAGTTGAACATA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 30.40% 26.70% 0.97% 0.00% A: 19.11%; CAAA: 11.45%; CA: 6.92%; CAA: 4.42%
All Indica  2759 5.80% 43.70% 1.01% 0.00% A: 24.36%; CAAA: 16.20%; CAA: 5.44%; CA: 3.52%
All Japonica  1512 81.10% 0.60% 0.73% 0.00% CA: 13.62%; CAA: 3.24%; CAAA: 0.53%; A: 0.20%
Aus  269 1.50% 7.40% 1.49% 0.00% A: 75.46%; CAAA: 11.52%; CAA: 2.60%
Indica I  595 0.80% 67.70% 0.84% 0.00% CAAA: 17.14%; CAA: 11.93%; CA: 0.84%; A: 0.67%
Indica II  465 21.50% 48.40% 1.08% 0.00% A: 25.81%; CAAA: 2.58%; CA: 0.65%
Indica III  913 1.00% 26.00% 0.77% 0.00% A: 38.55%; CAAA: 24.32%; CA: 8.00%; CAA: 1.42%
Indica Intermediate  786 5.90% 43.30% 1.40% 0.00% A: 24.94%; CAAA: 14.12%; CAA: 8.40%; CA: 2.04%
Temperate Japonica  767 91.00% 0.30% 1.17% 0.00% CAA: 6.26%; CA: 0.78%; CAAA: 0.52%
Tropical Japonica  504 62.50% 0.40% 0.20% 0.00% CA: 36.90%
Japonica Intermediate  241 88.40% 2.10% 0.41% 0.00% CA: 5.81%; CAAA: 1.66%; A: 1.24%; CAA: 0.41%
VI/Aromatic  96 5.20% 11.50% 0.00% 0.00% CAAA: 46.88%; CA: 19.79%; A: 15.62%; CAA: 1.04%
Intermediate  90 47.80% 18.90% 3.33% 0.00% CAAA: 11.11%; A: 11.11%; CA: 5.56%; CAA: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0500589004 C -> T LOC_Os05g02030.1 upstream_gene_variant ; 1262.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0500589004 C -> T LOC_Os05g02040.1 upstream_gene_variant ; 4352.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0500589004 C -> T LOC_Os05g02020-LOC_Os05g02030 intergenic_region ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0500589004 C -> CAAA LOC_Os05g02030.1 upstream_gene_variant ; 1261.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0500589004 C -> CAAA LOC_Os05g02040.1 upstream_gene_variant ; 4351.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0500589004 C -> CAAA LOC_Os05g02020-LOC_Os05g02030 intergenic_region ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0500589004 C -> CA LOC_Os05g02030.1 upstream_gene_variant ; 1261.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0500589004 C -> CA LOC_Os05g02040.1 upstream_gene_variant ; 4351.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0500589004 C -> CA LOC_Os05g02020-LOC_Os05g02030 intergenic_region ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0500589004 C -> A LOC_Os05g02030.1 upstream_gene_variant ; 1262.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0500589004 C -> A LOC_Os05g02040.1 upstream_gene_variant ; 4352.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0500589004 C -> A LOC_Os05g02020-LOC_Os05g02030 intergenic_region ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0500589004 C -> CAA LOC_Os05g02030.1 upstream_gene_variant ; 1261.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0500589004 C -> CAA LOC_Os05g02040.1 upstream_gene_variant ; 4351.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0500589004 C -> CAA LOC_Os05g02020-LOC_Os05g02030 intergenic_region ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0500589004 C A -0.01 -0.04 -0.03 0.0 0.01 0.04
vg0500589004 C CA 0.03 0.03 0.05 -0.02 0.03 0.02
vg0500589004 C CAA -0.13 0.29 0.24 -0.05 0.03 0.06
vg0500589004 C CAAA -0.42 0.27 0.11 -0.01 0.08 0.09
vg0500589004 C T 0.01 -0.05 -0.04 0.0 -0.02 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0500589004 NA 9.94E-06 mr1179 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500589004 NA 8.57E-10 mr1198 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500589004 NA 1.27E-06 mr1420 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500589004 NA 1.99E-06 mr1508 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500589004 NA 4.32E-06 mr1681 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500589004 NA 9.95E-06 mr1729 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500589004 NA 4.80E-06 mr1729 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500589004 NA 5.99E-14 mr1751 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500589004 NA 2.08E-07 mr1751 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500589004 NA 7.63E-06 mr1802 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500589004 NA 1.27E-06 mr1807 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500589004 NA 8.49E-16 mr1830 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500589004 NA 3.54E-06 mr1830 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251