\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0500532312:

Variant ID: vg0500532312 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 532312
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.66, C: 0.34, others allele: 0.00, population size: 73. )

Flanking Sequence (100 bp) in Reference Genome:


CTAAAGATCCTCGGCCCCCTGACATACATCTGACAAGGGATAAACTGGGACTAAAGATCATCTTTAGTCCCGGTTGGTAGCACCAACTGGGACTAAAGAT[T/C]
AAAATTTTTATAACCGGAACTAAAAACAATCTTTAGTCCCGGTTCTTTTTGGATCCGGGACTATTGTGGATTTTGCCGGACCGATGAAAGATGGTTTTTC

Reverse complement sequence

GAAAAACCATCTTTCATCGGTCCGGCAAAATCCACAATAGTCCCGGATCCAAAAAGAACCGGGACTAAAGATTGTTTTTAGTTCCGGTTATAAAAATTTT[A/G]
ATCTTTAGTCCCAGTTGGTGCTACCAACCGGGACTAAAGATGATCTTTAGTCCCAGTTTATCCCTTGTCAGATGTATGTCAGGGGGCCGAGGATCTTTAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.60% 37.50% 9.35% 4.51% NA
All Indica  2759 73.60% 8.10% 10.73% 7.54% NA
All Japonica  1512 3.70% 95.60% 0.46% 0.20% NA
Aus  269 54.30% 16.00% 29.74% 0.00% NA
Indica I  595 61.30% 14.30% 13.95% 10.42% NA
Indica II  465 67.50% 6.90% 12.90% 12.69% NA
Indica III  913 81.70% 8.10% 7.78% 2.41% NA
Indica Intermediate  786 77.10% 4.20% 10.43% 8.27% NA
Temperate Japonica  767 6.60% 92.80% 0.26% 0.26% NA
Tropical Japonica  504 0.00% 100.00% 0.00% 0.00% NA
Japonica Intermediate  241 2.10% 95.40% 2.07% 0.41% NA
VI/Aromatic  96 36.50% 8.30% 54.17% 1.04% NA
Intermediate  90 32.20% 58.90% 7.78% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0500532312 T -> DEL N N silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0500532312 T -> C LOC_Os05g01920.1 upstream_gene_variant ; 3308.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0500532312 T -> C LOC_Os05g01920-LOC_Os05g01940 intergenic_region ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0500532312 NA 5.53E-06 mr1006 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500532312 NA 5.28E-06 mr1052 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500532312 NA 1.22E-08 mr1201 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500532312 NA 1.19E-09 mr1219 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500532312 NA 3.81E-09 mr1274 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500532312 NA 4.70E-06 mr1445 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500532312 NA 3.63E-11 mr1683 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500532312 NA 6.68E-11 mr1751 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500532312 NA 1.24E-17 mr1767 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500532312 NA 2.01E-08 mr1776 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500532312 NA 2.77E-07 mr1779 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500532312 NA 1.34E-22 mr1839 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500532312 NA 3.30E-14 mr1909 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500532312 5.41E-06 1.05E-11 mr1201_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500532312 2.06E-06 5.16E-13 mr1219_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500532312 NA 4.76E-09 mr1274_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500532312 NA 6.23E-16 mr1557_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500532312 NA 6.90E-12 mr1636_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500532312 NA 2.62E-12 mr1641_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500532312 NA 3.19E-15 mr1767_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500532312 NA 1.12E-20 mr1968_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251