Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0500532294:

Variant ID: vg0500532294 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 532294
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TATTGACACCAACCGGGACTAAAGATCCTCGGCCCCCTGACATACATCTGACAAGGGATAAACTGGGACTAAAGATCATCTTTAGTCCCGGTTGGTAGCA[C/T]
CAACTGGGACTAAAGATTAAAATTTTTATAACCGGAACTAAAAACAATCTTTAGTCCCGGTTCTTTTTGGATCCGGGACTATTGTGGATTTTGCCGGACC

Reverse complement sequence

GGTCCGGCAAAATCCACAATAGTCCCGGATCCAAAAAGAACCGGGACTAAAGATTGTTTTTAGTTCCGGTTATAAAAATTTTAATCTTTAGTCCCAGTTG[G/A]
TGCTACCAACCGGGACTAAAGATGATCTTTAGTCCCAGTTTATCCCTTGTCAGATGTATGTCAGGGGGCCGAGGATCTTTAGTCCCGGTTGGTGTCAATA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.30%	37.90%	4.89%	3.91%	NA
All Indica	2759	81.60%	5.80%	6.05%	6.60%	NA
All Japonica	1512	3.90%	95.60%	0.40%	0.07%	NA
Aus	269	56.50%	43.50%	0.00%	0.00%	NA
Indica I	595	64.00%	14.30%	12.44%	9.24%	NA
Indica II	465	73.10%	7.30%	7.74%	11.83%	NA
Indica III	913	96.20%	1.10%	1.20%	1.53%	NA
Indica Intermediate	786	82.80%	3.90%	5.85%	7.38%	NA
Temperate Japonica	767	6.90%	92.80%	0.26%	0.00%	NA
Tropical Japonica	504	0.20%	99.80%	0.00%	0.00%	NA
Japonica Intermediate	241	2.10%	95.90%	1.66%	0.41%	NA
VI/Aromatic	96	30.20%	10.40%	58.33%	1.04%	NA
Intermediate	90	34.40%	62.20%	2.22%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0500532294	C -> T	LOC_Os05g01920.1	upstream_gene_variant ; 3290.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0500532294	C -> T	LOC_Os05g01920-LOC_Os05g01940	intergenic_region ; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0500532294	C -> DEL	N	N	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0500532294	NA	7.46E-09	mr1201	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500532294	NA	1.29E-09	mr1219	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500532294	NA	5.36E-08	mr1274	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500532294	NA	2.56E-06	mr1527	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500532294	NA	4.34E-11	mr1751	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500532294	8.10E-06	NA	mr1201_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500532294	3.30E-06	2.02E-11	mr1201_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500532294	4.36E-06	3.70E-12	mr1219_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500532294	NA	1.40E-08	mr1274_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251