\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0500532294:

Variant ID: vg0500532294 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 532294
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TATTGACACCAACCGGGACTAAAGATCCTCGGCCCCCTGACATACATCTGACAAGGGATAAACTGGGACTAAAGATCATCTTTAGTCCCGGTTGGTAGCA[C/T]
CAACTGGGACTAAAGATTAAAATTTTTATAACCGGAACTAAAAACAATCTTTAGTCCCGGTTCTTTTTGGATCCGGGACTATTGTGGATTTTGCCGGACC

Reverse complement sequence

GGTCCGGCAAAATCCACAATAGTCCCGGATCCAAAAAGAACCGGGACTAAAGATTGTTTTTAGTTCCGGTTATAAAAATTTTAATCTTTAGTCCCAGTTG[G/A]
TGCTACCAACCGGGACTAAAGATGATCTTTAGTCCCAGTTTATCCCTTGTCAGATGTATGTCAGGGGGCCGAGGATCTTTAGTCCCGGTTGGTGTCAATA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.30% 37.90% 4.89% 3.91% NA
All Indica  2759 81.60% 5.80% 6.05% 6.60% NA
All Japonica  1512 3.90% 95.60% 0.40% 0.07% NA
Aus  269 56.50% 43.50% 0.00% 0.00% NA
Indica I  595 64.00% 14.30% 12.44% 9.24% NA
Indica II  465 73.10% 7.30% 7.74% 11.83% NA
Indica III  913 96.20% 1.10% 1.20% 1.53% NA
Indica Intermediate  786 82.80% 3.90% 5.85% 7.38% NA
Temperate Japonica  767 6.90% 92.80% 0.26% 0.00% NA
Tropical Japonica  504 0.20% 99.80% 0.00% 0.00% NA
Japonica Intermediate  241 2.10% 95.90% 1.66% 0.41% NA
VI/Aromatic  96 30.20% 10.40% 58.33% 1.04% NA
Intermediate  90 34.40% 62.20% 2.22% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0500532294 C -> T LOC_Os05g01920.1 upstream_gene_variant ; 3290.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0500532294 C -> T LOC_Os05g01920-LOC_Os05g01940 intergenic_region ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0500532294 C -> DEL N N silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0500532294 NA 7.46E-09 mr1201 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500532294 NA 1.29E-09 mr1219 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500532294 NA 5.36E-08 mr1274 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500532294 NA 2.56E-06 mr1527 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500532294 NA 4.34E-11 mr1751 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500532294 8.10E-06 NA mr1201_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500532294 3.30E-06 2.02E-11 mr1201_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500532294 4.36E-06 3.70E-12 mr1219_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500532294 NA 1.40E-08 mr1274_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251