\
| Variant ID: vg0500532294 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 532294 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
TATTGACACCAACCGGGACTAAAGATCCTCGGCCCCCTGACATACATCTGACAAGGGATAAACTGGGACTAAAGATCATCTTTAGTCCCGGTTGGTAGCA[C/T]
CAACTGGGACTAAAGATTAAAATTTTTATAACCGGAACTAAAAACAATCTTTAGTCCCGGTTCTTTTTGGATCCGGGACTATTGTGGATTTTGCCGGACC
GGTCCGGCAAAATCCACAATAGTCCCGGATCCAAAAAGAACCGGGACTAAAGATTGTTTTTAGTTCCGGTTATAAAAATTTTAATCTTTAGTCCCAGTTG[G/A]
TGCTACCAACCGGGACTAAAGATGATCTTTAGTCCCAGTTTATCCCTTGTCAGATGTATGTCAGGGGGCCGAGGATCTTTAGTCCCGGTTGGTGTCAATA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.30% | 37.90% | 4.89% | 3.91% | NA |
| All Indica | 2759 | 81.60% | 5.80% | 6.05% | 6.60% | NA |
| All Japonica | 1512 | 3.90% | 95.60% | 0.40% | 0.07% | NA |
| Aus | 269 | 56.50% | 43.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 64.00% | 14.30% | 12.44% | 9.24% | NA |
| Indica II | 465 | 73.10% | 7.30% | 7.74% | 11.83% | NA |
| Indica III | 913 | 96.20% | 1.10% | 1.20% | 1.53% | NA |
| Indica Intermediate | 786 | 82.80% | 3.90% | 5.85% | 7.38% | NA |
| Temperate Japonica | 767 | 6.90% | 92.80% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 0.20% | 99.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 2.10% | 95.90% | 1.66% | 0.41% | NA |
| VI/Aromatic | 96 | 30.20% | 10.40% | 58.33% | 1.04% | NA |
| Intermediate | 90 | 34.40% | 62.20% | 2.22% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0500532294 | C -> T | LOC_Os05g01920.1 | upstream_gene_variant ; 3290.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0500532294 | C -> T | LOC_Os05g01920-LOC_Os05g01940 | intergenic_region ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0500532294 | C -> DEL | N | N | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0500532294 | NA | 7.46E-09 | mr1201 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0500532294 | NA | 1.29E-09 | mr1219 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0500532294 | NA | 5.36E-08 | mr1274 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0500532294 | NA | 2.56E-06 | mr1527 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0500532294 | NA | 4.34E-11 | mr1751 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0500532294 | 8.10E-06 | NA | mr1201_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0500532294 | 3.30E-06 | 2.02E-11 | mr1201_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0500532294 | 4.36E-06 | 3.70E-12 | mr1219_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0500532294 | NA | 1.40E-08 | mr1274_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |