Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0500526354:

Variant ID: vg0500526354 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 526354
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CGCGGCCTCATCCGTCTCTAGGGGAGGGAGGAGGAAGGGAAGGGGAAGGAAGGAGGAGCGGCCTCATCCGTCTCCAGGGGAGGGAGGAGGACGCGTGGCG[T/C]
AGCCTCATCCATCTCTAGGGGAGGGAGGAGGAAGGGAAGGGGAAGGAAGGAGGAGAGGCCTCATCCGTCTCCAGGGGAGGGAGGAGGAAGGGAAGGGAGA

Reverse complement sequence

TCTCCCTTCCCTTCCTCCTCCCTCCCCTGGAGACGGATGAGGCCTCTCCTCCTTCCTTCCCCTTCCCTTCCTCCTCCCTCCCCTAGAGATGGATGAGGCT[A/G]
CGCCACGCGTCCTCCTCCCTCCCCTGGAGACGGATGAGGCCGCTCCTCCTTCCTTCCCCTTCCCTTCCTCCTCCCTCCCCTAGAGACGGATGAGGCCGCG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	39.80%	22.20%	13.92%	24.06%	NA
All Indica	2759	11.10%	25.30%	23.27%	40.41%	NA
All Japonica	1512	96.00%	3.60%	0.07%	0.33%	NA
Aus	269	2.20%	97.00%	0.37%	0.37%	NA
Indica I	595	18.50%	17.50%	13.28%	50.76%	NA
Indica II	465	12.50%	13.80%	30.11%	43.66%	NA
Indica III	913	8.20%	33.60%	25.30%	32.86%	NA
Indica Intermediate	786	7.90%	28.20%	24.43%	39.44%	NA
Temperate Japonica	767	93.00%	6.80%	0.00%	0.26%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	97.50%	0.80%	0.41%	1.24%	NA
VI/Aromatic	96	69.80%	18.80%	3.12%	8.33%	NA
Intermediate	90	58.90%	20.00%	12.22%	8.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0500526354	T -> DEL	N	N	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0500526354	T -> C	LOC_Os05g01910.1	upstream_gene_variant ; 3409.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0500526354	T -> C	LOC_Os05g01920.1	downstream_gene_variant ; 2435.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0500526354	T -> C	LOC_Os05g01910-LOC_Os05g01920	intergenic_region ; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0500526354	NA	7.46E-06	mr1066	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500526354	NA	6.67E-07	mr1126	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500526354	NA	1.76E-13	mr1166	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500526354	NA	5.90E-06	mr1171	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500526354	NA	2.65E-06	mr1286	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500526354	NA	6.96E-07	mr1328	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500526354	NA	5.82E-06	mr1397	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500526354	NA	3.49E-09	mr1574	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500526354	NA	1.64E-06	mr1665	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500526354	NA	9.89E-17	mr1897	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500526354	NA	8.27E-06	mr1988	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500526354	NA	8.71E-07	mr1743_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251