Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0500328316:

Variant ID: vg0500328316 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 328316
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.71, C: 0.28, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:

TATAATCAAACATTTTTAAGTTTAATTAAGTTTATAAAAAAATATAATAATATTTTCAACACAGAATAAACGTATTATATATTTGTCTAACTCTAAAACT[T/C]
TTTGGGCCTGTTTTGATCTGGCAACACAGCCCAAAGAGATTCCACGTCTTGAAATTCCTATACATTAGCAAATGTGAAGCCAACACCATTGACAAATTCC

Reverse complement sequence

GGAATTTGTCAATGGTGTTGGCTTCACATTTGCTAATGTATAGGAATTTCAAGACGTGGAATCTCTTTGGGCTGTGTTGCCAGATCAAAACAGGCCCAAA[A/G]
AGTTTTAGAGTTAGACAAATATATAATACGTTTATTCTGTGTTGAAAATATTATTATATTTTTTTATAAACTTAATTAAACTTAAAAATGTTTGATTATA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	62.90%	36.80%	0.25%	0.00%	NA
All Indica	2759	43.70%	56.00%	0.33%	0.00%	NA
All Japonica	1512	96.00%	3.80%	0.20%	0.00%	NA
Aus	269	84.80%	15.20%	0.00%	0.00%	NA
Indica I	595	16.50%	82.90%	0.67%	0.00%	NA
Indica II	465	48.40%	51.20%	0.43%	0.00%	NA
Indica III	913	58.90%	41.10%	0.00%	0.00%	NA
Indica Intermediate	786	43.80%	55.90%	0.38%	0.00%	NA
Temperate Japonica	767	93.40%	6.30%	0.39%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	95.90%	4.10%	0.00%	0.00%	NA
VI/Aromatic	96	29.20%	70.80%	0.00%	0.00%	NA
Intermediate	90	67.80%	32.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0500328316	T -> C	LOC_Os05g01550.1	upstream_gene_variant ; 3895.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0500328316	T -> C	LOC_Os05g01560.1	upstream_gene_variant ; 154.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0500328316	T -> C	LOC_Os05g01560.2	upstream_gene_variant ; 154.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0500328316	T -> C	LOC_Os05g01560-LOC_Os05g01570	intergenic_region ; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0500328316	NA	6.39E-06	mr1060	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500328316	NA	2.93E-06	mr1318	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500328316	NA	8.62E-06	mr1630	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500328316	NA	4.64E-07	mr1679	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500328316	NA	1.71E-07	mr1691	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500328316	NA	5.12E-08	mr1693	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500328316	NA	7.28E-07	mr1728	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500328316	NA	3.54E-11	mr1751	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500328316	NA	4.55E-06	mr1751	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500328316	NA	7.66E-15	mr1807	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500328316	NA	3.50E-06	mr1958	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500328316	NA	5.95E-06	mr1153_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500328316	NA	2.35E-10	mr1198_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500328316	NA	6.93E-07	mr1405_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500328316	NA	9.64E-06	mr1407_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500328316	NA	2.77E-06	mr1516_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500328316	NA	1.05E-07	mr1668_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500328316	NA	2.12E-06	mr1679_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500328316	NA	3.84E-06	mr1691_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500328316	NA	5.86E-07	mr1740_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500328316	NA	3.34E-07	mr1740_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500328316	NA	8.64E-06	mr1741_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500328316	NA	3.27E-09	mr1751_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500328316	NA	7.85E-07	mr1863_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251