Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0500282600:

Variant ID: vg0500282600 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 282600
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.84, A: 0.16, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:

TTGAAGCTGTCATATTTATTTACAAGTGTCAGCTTCATATGATGATGCATGCTAAATTTATTATCACTGTATTTTATCAACTATAGTATACTAGTAATAT[G/A]
CTCGTACTAACGTTACGGTAGTATTTATTAATGCAAATCAAACAATCAAGAGAATTATATGTTTTGGCTATCAAGCATAAAATGAGATAGGTTTAGTTTT

Reverse complement sequence

AAAACTAAACCTATCTCATTTTATGCTTGATAGCCAAAACATATAATTCTCTTGATTGTTTGATTTGCATTAATAAATACTACCGTAACGTTAGTACGAG[C/T]
ATATTACTAGTATACTATAGTTGATAAAATACAGTGATAATAAATTTAGCATGCATCATCATATGAAGCTGACACTTGTAAATAAATATGACAGCTTCAA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.10%	49.60%	0.38%	0.00%	NA
All Indica	2759	76.70%	22.80%	0.51%	0.00%	NA
All Japonica	1512	3.20%	96.80%	0.00%	0.00%	NA
Aus	269	55.00%	43.90%	1.12%	0.00%	NA
Indica I	595	86.70%	12.90%	0.34%	0.00%	NA
Indica II	465	81.70%	18.10%	0.22%	0.00%	NA
Indica III	913	62.10%	37.90%	0.00%	0.00%	NA
Indica Intermediate	786	83.00%	15.60%	1.40%	0.00%	NA
Temperate Japonica	767	5.30%	94.70%	0.00%	0.00%	NA
Tropical Japonica	504	0.20%	99.80%	0.00%	0.00%	NA
Japonica Intermediate	241	2.90%	97.10%	0.00%	0.00%	NA
VI/Aromatic	96	18.80%	81.20%	0.00%	0.00%	NA
Intermediate	90	40.00%	58.90%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0500282600	G -> A	LOC_Os05g01470.1	upstream_gene_variant ; 4540.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0500282600	G -> A	LOC_Os05g01480.1	upstream_gene_variant ; 2370.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0500282600	G -> A	LOC_Os05g01470.3	upstream_gene_variant ; 4540.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0500282600	G -> A	LOC_Os05g01490.1	downstream_gene_variant ; 4762.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0500282600	G -> A	LOC_Os05g01490.2	downstream_gene_variant ; 4762.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0500282600	G -> A	LOC_Os05g01470-LOC_Os05g01480	intergenic_region ; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0500282600	NA	7.83E-06	mr1066	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500282600	NA	1.22E-07	mr1190	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500282600	NA	3.93E-06	mr1215	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500282600	NA	7.85E-06	mr1236	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500282600	NA	1.37E-06	mr1278	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500282600	NA	5.60E-07	mr1338	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500282600	NA	5.45E-09	mr1352	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500282600	NA	9.70E-06	mr1382	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500282600	NA	8.34E-06	mr1418	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500282600	NA	9.67E-08	mr1439	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500282600	2.54E-06	5.26E-08	mr1445	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500282600	NA	7.35E-06	mr1461	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500282600	NA	5.29E-08	mr1488	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500282600	NA	1.06E-08	mr1506	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500282600	NA	7.95E-06	mr1508	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500282600	NA	8.85E-07	mr1516	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500282600	NA	1.49E-07	mr1604	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500282600	NA	4.28E-09	mr1776	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251