\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0500274972:

Variant ID: vg0500274972 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 274972
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATACGTGTTCTTATAGTGATTTAAAAGTAAAGATTGGAAAATAAATTGTAATCAAAAAGCCTAAAACAACTCTAAATTTAAAGTTAAAAATTCAAATTTT[G/A]
GCTTATAAGTATAAGTATAAGCGAAAAGATGAGGTTGTTCTCATTATTTCTTTTCCTCTTTTTTATTTTCTCAAAGGTATTACTATTAGGGTTTTTTTTG

Reverse complement sequence

CAAAAAAAACCCTAATAGTAATACCTTTGAGAAAATAAAAAAGAGGAAAAGAAATAATGAGAACAACCTCATCTTTTCGCTTATACTTATACTTATAAGC[C/T]
AAAATTTGAATTTTTAACTTTAAATTTAGAGTTGTTTTAGGCTTTTTGATTACAATTTATTTTCCAATCTTTACTTTTAAATCACTATAAGAACACGTAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.80% 15.70% 0.55% 0.00% NA
All Indica  2759 88.50% 11.00% 0.54% 0.00% NA
All Japonica  1512 76.20% 23.20% 0.60% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 89.60% 9.90% 0.50% 0.00% NA
Indica II  465 90.80% 8.80% 0.43% 0.00% NA
Indica III  913 81.80% 17.40% 0.77% 0.00% NA
Indica Intermediate  786 94.00% 5.60% 0.38% 0.00% NA
Temperate Japonica  767 97.00% 2.90% 0.13% 0.00% NA
Tropical Japonica  504 40.10% 58.50% 1.39% 0.00% NA
Japonica Intermediate  241 85.50% 14.10% 0.41% 0.00% NA
VI/Aromatic  96 20.80% 77.10% 2.08% 0.00% NA
Intermediate  90 88.90% 11.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0500274972 G -> A LOC_Os05g01470.2 upstream_gene_variant ; 334.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0500274972 G -> A LOC_Os05g01470.1 intron_variant ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0500274972 G -> A LOC_Os05g01470.3 intron_variant ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0500274972 G A 0.01 0.02 0.03 -0.01 0.0 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0500274972 7.60E-07 4.36E-08 mr1029 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500274972 NA 1.72E-06 mr1149 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500274972 NA 2.64E-06 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500274972 NA 9.62E-06 mr1277 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500274972 NA 3.94E-06 mr1625 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500274972 2.83E-06 4.29E-09 mr1642 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500274972 NA 1.24E-06 mr1642 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500274972 NA 4.28E-06 mr1782 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500274972 5.92E-06 NA mr1815 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500274972 NA 8.43E-06 mr1930 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500274972 NA 2.74E-06 mr1990 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500274972 NA 1.32E-07 mr1047_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500274972 NA 5.81E-06 mr1686_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500274972 NA 1.49E-06 mr1925_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251