Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0500274972:

Variant ID: vg0500274972 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 274972
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATACGTGTTCTTATAGTGATTTAAAAGTAAAGATTGGAAAATAAATTGTAATCAAAAAGCCTAAAACAACTCTAAATTTAAAGTTAAAAATTCAAATTTT[G/A]
GCTTATAAGTATAAGTATAAGCGAAAAGATGAGGTTGTTCTCATTATTTCTTTTCCTCTTTTTTATTTTCTCAAAGGTATTACTATTAGGGTTTTTTTTG

Reverse complement sequence

CAAAAAAAACCCTAATAGTAATACCTTTGAGAAAATAAAAAAGAGGAAAAGAAATAATGAGAACAACCTCATCTTTTCGCTTATACTTATACTTATAAGC[C/T]
AAAATTTGAATTTTTAACTTTAAATTTAGAGTTGTTTTAGGCTTTTTGATTACAATTTATTTTCCAATCTTTACTTTTAAATCACTATAAGAACACGTAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	83.80%	15.70%	0.55%	0.00%	NA
All Indica	2759	88.50%	11.00%	0.54%	0.00%	NA
All Japonica	1512	76.20%	23.20%	0.60%	0.00%	NA
Aus	269	99.30%	0.70%	0.00%	0.00%	NA
Indica I	595	89.60%	9.90%	0.50%	0.00%	NA
Indica II	465	90.80%	8.80%	0.43%	0.00%	NA
Indica III	913	81.80%	17.40%	0.77%	0.00%	NA
Indica Intermediate	786	94.00%	5.60%	0.38%	0.00%	NA
Temperate Japonica	767	97.00%	2.90%	0.13%	0.00%	NA
Tropical Japonica	504	40.10%	58.50%	1.39%	0.00%	NA
Japonica Intermediate	241	85.50%	14.10%	0.41%	0.00%	NA
VI/Aromatic	96	20.80%	77.10%	2.08%	0.00%	NA
Intermediate	90	88.90%	11.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0500274972	G -> A	LOC_Os05g01470.2	upstream_gene_variant ; 334.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0500274972	G -> A	LOC_Os05g01470.1	intron_variant ; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0500274972	G -> A	LOC_Os05g01470.3	intron_variant ; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0500274972	G	A	0.01	0.02	0.03	-0.01	0.0	-0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0500274972	7.60E-07	4.36E-08	mr1029	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500274972	NA	1.72E-06	mr1149	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500274972	NA	2.64E-06	mr1189	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500274972	NA	9.62E-06	mr1277	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500274972	NA	3.94E-06	mr1625	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500274972	2.83E-06	4.29E-09	mr1642	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500274972	NA	1.24E-06	mr1642	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500274972	NA	4.28E-06	mr1782	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500274972	5.92E-06	NA	mr1815	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500274972	NA	8.43E-06	mr1930	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500274972	NA	2.74E-06	mr1990	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500274972	NA	1.32E-07	mr1047_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500274972	NA	5.81E-06	mr1686_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500274972	NA	1.49E-06	mr1925_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251