Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0500206143:

Variant ID: vg0500206143 (JBrowse)	Variation Type: INDEL
Chromosome: chr05	Position: 206143
Reference Allele: CCATCT	Alternative Allele: C,TCATCT
Primary Allele: CCATCT	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTTGAAAATTGCTCATTCCCAAGCTAGATCGTGCTCATCTAGTGTGATTGCGTGATAAGTCCAACTCAAACTTGTTCTTAGCCAAAGATTAGTGCTACTT[CCATCT/C,TCATCT]
CATCTCGTGACAAACAAGTCTCTCACCCAACCTAGAGTCGAGGAATAGCCCAAGAATAAACTCAAGTCGGACTCAGCTCGTAGCCACACTAGAAGAGCCT

Reverse complement sequence

AGGCTCTTCTAGTGTGGCTACGAGCTGAGTCCGACTTGAGTTTATTCTTGGGCTATTCCTCGACTCTAGGTTGGGTGAGAGACTTGTTTGTCACGAGATG[AGATGG/G,AGATGA]
AAGTAGCACTAATCTTTGGCTAAGAACAAGTTTGAGTTGGACTTATCACGCAATCACACTAGATGAGCACGATCTAGCTTGGGAATGAGCAATTTTCAAA

Allele Frequencies:

Populations	Population Size	Frequency of CCATCT(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.10%	48.20%	1.63%	0.00%	TCATCT: 0.02%
All Indica	2759	66.70%	32.80%	0.51%	0.00%	TCATCT: 0.04%
All Japonica	1512	23.10%	73.10%	3.77%	0.00%	NA
Aus	269	47.60%	52.00%	0.37%	0.00%	NA
Indica I	595	82.00%	17.10%	0.84%	0.00%	NA
Indica II	465	83.20%	15.90%	0.86%	0.00%	NA
Indica III	913	46.70%	53.20%	0.11%	0.00%	NA
Indica Intermediate	786	68.40%	30.90%	0.51%	0.00%	TCATCT: 0.13%
Temperate Japonica	767	42.10%	52.20%	5.74%	0.00%	NA
Tropical Japonica	504	1.20%	98.00%	0.79%	0.00%	NA
Japonica Intermediate	241	8.30%	88.00%	3.73%	0.00%	NA
VI/Aromatic	96	10.40%	88.50%	1.04%	0.00%	NA
Intermediate	90	46.70%	48.90%	4.44%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0500206143	CCATCT -> TCATCT	LOC_Os05g01310.1	upstream_gene_variant ; 4512.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0500206143	CCATCT -> TCATCT	LOC_Os05g01320.1	upstream_gene_variant ; 387.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0500206143	CCATCT -> TCATCT	LOC_Os05g01310.2	upstream_gene_variant ; 4512.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0500206143	CCATCT -> TCATCT	LOC_Os05g01310.3	upstream_gene_variant ; 4512.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0500206143	CCATCT -> TCATCT	LOC_Os05g01330.1	downstream_gene_variant ; 1710.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0500206143	CCATCT -> TCATCT	LOC_Os05g01320-LOC_Os05g01330	intergenic_region ; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0500206143	CCATCT -> C	LOC_Os05g01310.1	upstream_gene_variant ; 4513.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0500206143	CCATCT -> C	LOC_Os05g01320.1	upstream_gene_variant ; 388.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0500206143	CCATCT -> C	LOC_Os05g01310.2	upstream_gene_variant ; 4513.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0500206143	CCATCT -> C	LOC_Os05g01310.3	upstream_gene_variant ; 4513.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0500206143	CCATCT -> C	LOC_Os05g01330.1	downstream_gene_variant ; 1709.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0500206143	CCATCT -> C	LOC_Os05g01320-LOC_Os05g01330	intergenic_region ; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0500206143	NA	9.25E-07	mr1215	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500206143	NA	7.76E-07	mr1236	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500206143	NA	1.39E-07	mr1249	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500206143	NA	2.92E-10	mr1352	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500206143	NA	2.12E-06	mr1445	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500206143	NA	6.16E-12	mr1751	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500206143	NA	8.48E-07	mr1045_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500206143	NA	1.67E-08	mr1084_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500206143	NA	2.51E-06	mr1105_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500206143	NA	3.34E-06	mr1115_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500206143	NA	8.72E-10	mr1198_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500206143	NA	4.88E-08	mr1215_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500206143	NA	9.84E-06	mr1215_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500206143	NA	9.12E-08	mr1236_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500206143	NA	4.38E-06	mr1283_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500206143	3.67E-06	3.66E-06	mr1307_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500206143	NA	3.28E-06	mr1318_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500206143	NA	4.79E-08	mr1376_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500206143	NA	9.09E-06	mr1376_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500206143	NA	1.48E-06	mr1396_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500206143	NA	2.03E-08	mr1431_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500206143	NA	8.23E-06	mr1431_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500206143	NA	1.36E-06	mr1624_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500206143	NA	7.56E-06	mr1729_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500206143	NA	8.55E-08	mr1740_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500206143	NA	1.08E-08	mr1751_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500206143	NA	4.21E-06	mr1751_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500206143	NA	5.55E-06	mr1785_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500206143	NA	4.11E-06	mr1788_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500206143	NA	3.54E-06	mr1800_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500206143	NA	8.24E-06	mr1863_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500206143	NA	3.84E-06	mr1922_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500206143	NA	6.49E-06	mr1943_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251